Plots isochores in large DNA sequences emboss emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -outfile $ofile2 -goutfile $ofile1 -graph png -window $window -shift $shift -auto Sequences Window size Shift increment .. class:: warningmark The input dataset needs to be sequences. ----- **Syntax** This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_. .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/isochore.html - Both **Window size** and **Shift increment** are intergers. ----- **Example** - Input sequences:: >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA GCGGTTTCCAAGAGGATACAGTA - Output data file:: Position Percent G+C 1 .. 323 80 0.422 112 0.460 144 0.509 176 0.534 208 0.553 240 0.553 - Output graphics file: .. image:: ../static/emboss_icons/isochore.png