converts tabular file to FASTA format tabular_to_fasta.py $input $title_col $seq_col $output

**What it does** Converts tab delimited data into FASTA formatted sequences. ----------- **Example** Suppose this is a sequence file produced by Illumina (Solexa) sequencer:: 5 300 902 419 GACTCATGATTTCTTACCTATTAGTGGTTGAACATC 5 300 880 431 GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT Selecting **c3** and **c4** as the **Title column(s)** and **c5** as the **Sequence column** will result in:: >902_419 GACTCATGATTTCTTACCTATTAGTGGTTGAACATC >880_431 GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT