on paired end reads fastq_paired_end_joiner.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$output_file'

**What it does** This tool joins paired end FASTQ reads from two separate files into a single read in one file. The join is performed using sequence identifiers, allowing the two files to contain differing ordering. If a sequence identifier does not appear in both files, it is excluded from the output. Sequence identifiers with /1 and /2 appended override the left-hand and right-hand designation; i.e. if the reads end with /1 and /2, the read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read. Sequences without this designation will follow the left-hand and right-hand settings set by the user. ----- **Input formats** Left-hand Read:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh Right-hand Read:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR ----- **Output** A multiple-fastq file, for example:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA +HWI-EAS91_1_30788AAXX:7:21:1542:1758 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR