[2] | 1 | <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0"> |
---|
| 2 | <description>on joined paired end reads</description> |
---|
| 3 | <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command> |
---|
| 4 | <inputs> |
---|
| 5 | <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" /> |
---|
| 6 | </inputs> |
---|
| 7 | <outputs> |
---|
| 8 | <data name="output1_file" format="input" /> |
---|
| 9 | <data name="output2_file" format="input" /> |
---|
| 10 | </outputs> |
---|
| 11 | <tests> |
---|
| 12 | <test> |
---|
| 13 | <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" /> |
---|
| 14 | <output name="output1_file" file="split_pair_reads_1.fastqsanger" /> |
---|
| 15 | <output name="output2_file" file="split_pair_reads_2.fastqsanger" /> |
---|
| 16 | </test> |
---|
| 17 | </tests> |
---|
| 18 | <help> |
---|
| 19 | **What it does** |
---|
| 20 | |
---|
| 21 | Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length. |
---|
| 22 | |
---|
| 23 | Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively. |
---|
| 24 | |
---|
| 25 | ----- |
---|
| 26 | |
---|
| 27 | **Input format** |
---|
| 28 | |
---|
| 29 | A multiple-fastq file, for example:: |
---|
| 30 | |
---|
| 31 | @HWI-EAS91_1_30788AAXX:7:21:1542:1758 |
---|
| 32 | GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA |
---|
| 33 | +HWI-EAS91_1_30788AAXX:7:21:1542:1758 |
---|
| 34 | hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR |
---|
| 35 | |
---|
| 36 | |
---|
| 37 | ----- |
---|
| 38 | |
---|
| 39 | **Outputs** |
---|
| 40 | |
---|
| 41 | Left-hand Read:: |
---|
| 42 | |
---|
| 43 | @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 |
---|
| 44 | GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC |
---|
| 45 | +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 |
---|
| 46 | hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh |
---|
| 47 | |
---|
| 48 | Right-hand Read:: |
---|
| 49 | |
---|
| 50 | @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 |
---|
| 51 | GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA |
---|
| 52 | +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 |
---|
| 53 | hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR |
---|
| 54 | |
---|
| 55 | </help> |
---|
| 56 | </tool> |
---|