[2] | 1 | <tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA"> |
---|
| 2 | <description>converter</description> |
---|
| 3 | <requirements><requirement type="package">fastx_toolkit</requirement></requirements>
|
---|
| 4 | <command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v </command> |
---|
| 5 | |
---|
| 6 | <inputs> |
---|
| 7 | <param format="fastq" name="input" type="data" label="FASTQ Library to convert" /> |
---|
| 8 | |
---|
| 9 | <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases "> |
---|
| 10 | <option value="">yes</option> |
---|
| 11 | <option value="-n">no</option> |
---|
| 12 | </param> |
---|
| 13 | |
---|
| 14 | <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)"> |
---|
| 15 | <option value="-r">yes</option> |
---|
| 16 | <option value="">no</option> |
---|
| 17 | </param> |
---|
| 18 | |
---|
| 19 | </inputs> |
---|
| 20 | |
---|
| 21 | <tests> |
---|
| 22 | <test> |
---|
| 23 | <!-- FASTQ-To-FASTA, keep N, don't rename --> |
---|
| 24 | <param name="input" value="fastq_to_fasta1.fastq" /> |
---|
| 25 | <param name="SKIPN" value=""/> |
---|
| 26 | <param name="RENAMESEQ" value=""/> |
---|
| 27 | <output name="output" file="fastq_to_fasta1a.out" /> |
---|
| 28 | </test> |
---|
| 29 | <test> |
---|
| 30 | <!-- FASTQ-To-FASTA, discard N, rename --> |
---|
| 31 | <param name="input" value="fastq_to_fasta1.fastq" /> |
---|
| 32 | <param name="SKIPN" value="no"/> |
---|
| 33 | <param name="RENAMESEQ" value="yes"/> |
---|
| 34 | <output name="output" file="fastq_to_fasta1b.out" /> |
---|
| 35 | </test> |
---|
| 36 | </tests> |
---|
| 37 | |
---|
| 38 | <outputs> |
---|
| 39 | <data format="fasta" name="output" metadata_source="input" /> |
---|
| 40 | </outputs> |
---|
| 41 | |
---|
| 42 | <help> |
---|
| 43 | |
---|
| 44 | **What it does** |
---|
| 45 | |
---|
| 46 | This tool converts data from Solexa format to FASTA format (scroll down for format description). |
---|
| 47 | |
---|
| 48 | -------- |
---|
| 49 | |
---|
| 50 | **Example** |
---|
| 51 | |
---|
| 52 | The following data in Solexa-FASTQ format:: |
---|
| 53 | |
---|
| 54 | @CSHL_4_FC042GAMMII_2_1_517_596 |
---|
| 55 | GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 56 | +CSHL_4_FC042GAMMII_2_1_517_596 |
---|
| 57 | 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 |
---|
| 58 | |
---|
| 59 | Will be converted to FASTA (with 'rename sequence names' = NO):: |
---|
| 60 | |
---|
| 61 | >CSHL_4_FC042GAMMII_2_1_517_596 |
---|
| 62 | GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 63 | |
---|
| 64 | Will be converted to FASTA (with 'rename sequence names' = YES):: |
---|
| 65 | |
---|
| 66 | >1 |
---|
| 67 | GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 68 | |
---|
| 69 | ------ |
---|
| 70 | |
---|
| 71 | This tool is based on `FASTX-toolkit`__ by Assaf Gordon. |
---|
| 72 | |
---|
| 73 | .. __: http://hannonlab.cshl.edu/fastx_toolkit/ |
---|
| 74 | </help> |
---|
| 75 | </tool> |
---|
| 76 | <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> |
---|