converterfastx_toolkitgunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v
**What it does**
This tool converts data from Solexa format to FASTA format (scroll down for format description).
--------
**Example**
The following data in Solexa-FASTQ format::
@CSHL_4_FC042GAMMII_2_1_517_596
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+CSHL_4_FC042GAMMII_2_1_517_596
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
Will be converted to FASTA (with 'rename sequence names' = NO)::
>CSHL_4_FC042GAMMII_2_1_517_596
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
Will be converted to FASTA (with 'rename sequence names' = YES)::
>1
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/