converter fastx_toolkit gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v yes no yes no

**What it does** This tool converts data from Solexa format to FASTA format (scroll down for format description). -------- **Example** The following data in Solexa-FASTQ format:: @CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Will be converted to FASTA (with 'rename sequence names' = NO):: >CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT Will be converted to FASTA (with 'rename sequence names' = YES):: >1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/