[2] | 1 | <tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" > |
---|
| 2 | <description>adapter sequences</description> |
---|
| 3 | <requirements><requirement type="package">fastx_toolkit</requirement></requirements>
|
---|
| 4 | <command> |
---|
| 5 | zcat -f $input | fastx_clipper -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS |
---|
| 6 | </command> |
---|
| 7 | |
---|
| 8 | <inputs> |
---|
| 9 | <param format="fasta,fastqsolexa" name="input" type="data" label="Library to clip" /> |
---|
| 10 | |
---|
| 11 | <param name="minlength" size="4" type="integer" value="15"> |
---|
| 12 | <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label> |
---|
| 13 | </param> |
---|
| 14 | |
---|
| 15 | <conditional name="clip_source"> |
---|
| 16 | <param name="clip_source_list" type="select" label="Source"> |
---|
| 17 | <option value="prebuilt" selected="true">Standard (select from the list below)</option> |
---|
| 18 | <option value="user">Enter custom sequence</option> |
---|
| 19 | </param> |
---|
| 20 | |
---|
| 21 | <when value="user"> |
---|
| 22 | <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> |
---|
| 23 | </when> |
---|
| 24 | |
---|
| 25 | <when value="prebuilt"> |
---|
| 26 | <param name="clip_sequence" type="select" label="Choose Adapter"> |
---|
| 27 | <options from_file="fastx_clipper_sequences.txt"> |
---|
| 28 | <column name="name" index="1"/> |
---|
| 29 | <column name="value" index="0"/> |
---|
| 30 | </options> |
---|
| 31 | </param> |
---|
| 32 | </when> |
---|
| 33 | </conditional> |
---|
| 34 | |
---|
| 35 | <param name="keepdelta" size="2" type="integer" value="0"> |
---|
| 36 | <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label> |
---|
| 37 | <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help> |
---|
| 38 | </param> |
---|
| 39 | |
---|
| 40 | <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> |
---|
| 41 | <option value="">Yes</option> |
---|
| 42 | <option value="-n">No</option> |
---|
| 43 | </param> |
---|
| 44 | |
---|
| 45 | <param name="DISCARD_OPTIONS" type="select" label="Output options"> |
---|
| 46 | <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option> |
---|
| 47 | <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option> |
---|
| 48 | <option value="">Output both clipped and non-clipped sequences</option> |
---|
| 49 | </param> |
---|
| 50 | |
---|
| 51 | </inputs> |
---|
| 52 | <!-- |
---|
| 53 | #functional test with param value starting with - fails. |
---|
| 54 | <tests> |
---|
| 55 | <test> |
---|
| 56 | <param name="input" value="fastx_clipper1.fastq" /> |
---|
| 57 | <param name="maxmismatches" value="2" /> |
---|
| 58 | <param name="minlength" value="15" /> |
---|
| 59 | <param name="clip_source_list" value="user" /> |
---|
| 60 | <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> |
---|
| 61 | <param name="keepdelta" value="0" /> |
---|
| 62 | <param name="KEEP_N" value="-n" /> |
---|
| 63 | <param name="DISCARD_OPTIONS" value="-c" /> |
---|
| 64 | <output name="output" file="fastx_clipper1a.out" /> |
---|
| 65 | </test> |
---|
| 66 | </tests> |
---|
| 67 | --> |
---|
| 68 | <outputs> |
---|
| 69 | <data format="input" name="output" metadata_source="input" /> |
---|
| 70 | </outputs> |
---|
| 71 | |
---|
| 72 | <help> |
---|
| 73 | **What it does** |
---|
| 74 | |
---|
| 75 | This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. |
---|
| 76 | |
---|
| 77 | -------- |
---|
| 78 | |
---|
| 79 | |
---|
| 80 | **Clipping Illustration:** |
---|
| 81 | |
---|
| 82 | .. image:: ./static/fastx_icons/fastx_clipper_illustration.png |
---|
| 83 | |
---|
| 84 | |
---|
| 85 | |
---|
| 86 | |
---|
| 87 | |
---|
| 88 | |
---|
| 89 | |
---|
| 90 | |
---|
| 91 | **Clipping Example:** |
---|
| 92 | |
---|
| 93 | .. image:: ./static/fastx_icons/fastx_clipper_example.png |
---|
| 94 | |
---|
| 95 | |
---|
| 96 | |
---|
| 97 | **In the above example:** |
---|
| 98 | |
---|
| 99 | * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). |
---|
| 100 | * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). |
---|
| 101 | |
---|
| 102 | |
---|
| 103 | |
---|
| 104 | |
---|
| 105 | </help> |
---|
| 106 | </tool> |
---|