[2] | 1 | <tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" > |
---|
| 2 | <description></description> |
---|
| 3 | <requirements><requirement type="package">fastx_toolkit</requirement></requirements>
|
---|
| 4 | <command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v </command> |
---|
| 5 | |
---|
| 6 | <inputs> |
---|
| 7 | <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" /> |
---|
| 8 | |
---|
| 9 | <param name="TYPE" type="select" label="Rename sequence identifiers to"> |
---|
| 10 | <option value="SEQ">Nucleotides sequence</option> |
---|
| 11 | <option value="COUNT">Numeric Counter</option> |
---|
| 12 | </param> |
---|
| 13 | </inputs> |
---|
| 14 | |
---|
| 15 | <outputs> |
---|
| 16 | <data format="input" name="output" metadata_source="input" /> |
---|
| 17 | </outputs> |
---|
| 18 | |
---|
| 19 | <help> |
---|
| 20 | |
---|
| 21 | **What it does** |
---|
| 22 | |
---|
| 23 | This tool renames the sequence identifiers in a FASTQ/A file. |
---|
| 24 | |
---|
| 25 | .. class:: infomark |
---|
| 26 | |
---|
| 27 | Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc). |
---|
| 28 | |
---|
| 29 | -------- |
---|
| 30 | |
---|
| 31 | **Example** |
---|
| 32 | |
---|
| 33 | The following Solexa-FASTQ file:: |
---|
| 34 | |
---|
| 35 | @CSHL_4_FC042GAMMII_2_1_517_596 |
---|
| 36 | GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 37 | +CSHL_4_FC042GAMMII_2_1_517_596 |
---|
| 38 | 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 |
---|
| 39 | |
---|
| 40 | Renamed to **nucleotides sequence**:: |
---|
| 41 | |
---|
| 42 | @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 43 | GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 44 | +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 45 | 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 |
---|
| 46 | |
---|
| 47 | Renamed to **numeric counter**:: |
---|
| 48 | |
---|
| 49 | @1 |
---|
| 50 | GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT |
---|
| 51 | +1 |
---|
| 52 | 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 |
---|
| 53 | |
---|
| 54 | ------ |
---|
| 55 | |
---|
| 56 | This tool is based on `FASTX-toolkit`__ by Assaf Gordon. |
---|
| 57 | |
---|
| 58 | .. __: http://hannonlab.cshl.edu/fastx_toolkit/ |
---|
| 59 | </help> |
---|
| 60 | </tool> |
---|
| 61 | <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> |
---|