fastx_toolkit
zcat -f $input | fastx_renamer -n $TYPE -o $output -v
**What it does**
This tool renames the sequence identifiers in a FASTQ/A file.
.. class:: infomark
Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).
--------
**Example**
The following Solexa-FASTQ file::
@CSHL_4_FC042GAMMII_2_1_517_596
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+CSHL_4_FC042GAMMII_2_1_517_596
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
Renamed to **nucleotides sequence**::
@GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
Renamed to **numeric counter**::
@1
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+1
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
------
This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
.. __: http://hannonlab.cshl.edu/fastx_toolkit/