fastx_toolkit zcat -f $input | fastx_renamer -n $TYPE -o $output -v Nucleotides sequence Numeric Counter **What it does** This tool renames the sequence identifiers in a FASTQ/A file. .. class:: infomark Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc). -------- **Example** The following Solexa-FASTQ file:: @CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Renamed to **nucleotides sequence**:: @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 Renamed to **numeric counter**:: @1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +1 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/