[2] | 1 | <tool id="cshl_fastx_trimmer" name="Trim sequences"> |
---|
| 2 | <description></description> |
---|
| 3 | <requirements><requirement type="package">fastx_toolkit</requirement></requirements>
|
---|
| 4 | <command>zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output</command> |
---|
| 5 | |
---|
| 6 | <inputs> |
---|
| 7 | <param format="fasta,fastqsanger" name="input" type="data" label="Library to clip" /> |
---|
| 8 | |
---|
| 9 | <param name="first" size="4" type="integer" value="1"> |
---|
| 10 | <label>First base to keep</label> |
---|
| 11 | </param> |
---|
| 12 | |
---|
| 13 | <param name="last" size="4" type="integer" value="21"> |
---|
| 14 | <label>Last base to keep</label> |
---|
| 15 | </param> |
---|
| 16 | </inputs> |
---|
| 17 | |
---|
| 18 | <tests> |
---|
| 19 | <test> |
---|
| 20 | <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) --> |
---|
| 21 | <param name="input" value="fastx_trimmer1.fasta" /> |
---|
| 22 | <param name="first" value="5"/> |
---|
| 23 | <param name="last" value="36"/> |
---|
| 24 | <output name="output" file="fastx_trimmer1.out" /> |
---|
| 25 | </test> |
---|
| 26 | <test> |
---|
| 27 | <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) --> |
---|
| 28 | <param name="input" value="fastx_trimmer2.fastq" /> |
---|
| 29 | <param name="first" value="1"/> |
---|
| 30 | <param name="last" value="27"/> |
---|
| 31 | <output name="output" file="fastx_trimmer2.out" /> |
---|
| 32 | </test> |
---|
| 33 | </tests> |
---|
| 34 | |
---|
| 35 | <outputs> |
---|
| 36 | <data format="input" name="output" metadata_source="input" /> |
---|
| 37 | </outputs> |
---|
| 38 | <help> |
---|
| 39 | **What it does** |
---|
| 40 | |
---|
| 41 | This tool trims (cut bases from) sequences in a FASTA/Q file. |
---|
| 42 | |
---|
| 43 | -------- |
---|
| 44 | |
---|
| 45 | **Example** |
---|
| 46 | |
---|
| 47 | Input Fasta file (with 36 bases in each sequences):: |
---|
| 48 | |
---|
| 49 | >1-1 |
---|
| 50 | TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC |
---|
| 51 | >2-1 |
---|
| 52 | CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA |
---|
| 53 | |
---|
| 54 | |
---|
| 55 | Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: |
---|
| 56 | |
---|
| 57 | >1-1 |
---|
| 58 | TATGGTCAGAAACCATATGCA |
---|
| 59 | >2-1 |
---|
| 60 | CAGCGAGGCTTTAATGCCATT |
---|
| 61 | |
---|
| 62 | Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences:: |
---|
| 63 | |
---|
| 64 | >1-1 |
---|
| 65 | TCAGA |
---|
| 66 | >2-1 |
---|
| 67 | AGGCT |
---|
| 68 | |
---|
| 69 | ------ |
---|
| 70 | |
---|
| 71 | This tool is based on `FASTX-toolkit`__ by Assaf Gordon. |
---|
| 72 | |
---|
| 73 | .. __: http://hannonlab.cshl.edu/fastx_toolkit/ |
---|
| 74 | |
---|
| 75 | </help> |
---|
| 76 | </tool> |
---|
| 77 | <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> |
---|