fastx_toolkit zcat -f '$input' | fastx_trimmer -v -f $first -l $last -o $output First base to keep Last base to keep

**What it does** This tool trims (cut bases from) sequences in a FASTA/Q file. -------- **Example** Input Fasta file (with 36 bases in each sequences):: >1-1 TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC >2-1 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base):: >1-1 TATGGTCAGAAACCATATGCA >2-1 CAGCGAGGCTTTAATGCCATT Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences:: >1-1 TCAGA >2-1 AGGCT ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/