Converts a MAF formated file to the BED format maf_to_bed.py $input1 $out_file1 $species $complete_blocks $__new_file_path__ include blocks with missing species exclude blocks with missing species

**What it does** This tool converts every MAF block to an interval line (in BED format; scroll down for description of MAF and BED formats) describing position of that alignment block within a corresponding genome. The interface for this tool contains two pages (steps): * **Step 1 of 2**. Choose multiple alignments from history to be converted to BED format. * **Step 2 of 2**. Choose species from the alignment to be included in the output and specify how to deal with alignment blocks that lack one or more species: * **Choose species** - the tool reads the alignment provided during Step 1 and generates a list of species contained within that alignment. Using checkboxes you can specify taxa to be included in the output (only reference genome, shown in **bold**, is selected by default). If you select more than one species, then more than one history item will be created. * **Choose to include/exclude blocks with missing species** - if an alignment block does not contain any one of the species you selected within **Choose species** menu and this option is set to **exclude blocks with missing species**, then coordinates of such a block **will not** be included in the output (see **Example 2** below). ----- **Example 1**: **Include only reference genome** (hg18 in this case) and **include blocks with missing species**: For the following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG the tool will create **a single** history item containing the following (**note** that field 4 is added to the output and is numbered iteratively: hg18_0, hg18_1 etc.):: chr20 56827368 56827443 hg18_0 0 + chr20 56827443 56827480 hg18_1 0 + ----- **Example 2**: **Include hg18 and mm8** and **exclude blocks with missing species**: For the following alignment:: ##maf version=1 a score=68686.000000 s hg18.chr20 56827368 75 + 62435964 GACAGGGTGCATCTGGGAGGG---CCTGCCGGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s panTro2.chr20 56528685 75 + 62293572 GACAGGGTGCATCTGAGAGGG---CCTGCCAGGCCTTTA-TTCAACACTAGATACGCCCCATCTCCAATTCTAATGGAC- s rheMac2.chr10 89144112 69 - 94855758 GACAGGGTGCATCTGAGAGGG---CCTGCTGGGCCTTTG-TTCAAAACTAGATATGCCCCAACTCCAATTCTA------- s mm8.chr2 173910832 61 + 181976762 AGAAGGATCCACCT------------TGCTGGGCCTCTGCTCCAGCAAGACCCACCTCCCAACTCAAATGCCC------- s canFam2.chr24 46551822 67 + 50763139 CG------GCGTCTGTAAGGGGCCACCGCCCGGCCTGTG-CTCAAAGCTACAAATGACTCAACTCCCAACCGA------C a score=10289.000000 s hg18.chr20 56827443 37 + 62435964 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s panTro2.chr20 56528760 37 + 62293572 ATGTGCAGAAAATGTGATACAGAAACCTGCAGAGCAG s rheMac2.chr10 89144181 37 - 94855758 ATGTGCGGAAAATGTGATACAGAAACCTGCAGAGCAG the tool will create **two** history items (one for hg18 and one fopr mm8) containing the following (**note** that both history items contain only one line describing the first alignment block. The second MAF block is not included in the output because it does not contain mm8): History item **1** (for hg18):: chr20 56827368 56827443 hg18_0 0 + History item **2** (for mm8):: chr2 173910832 173910893 mm8_0 0 + ------- .. class:: infomark **About formats** **MAF format** multiple alignment format file. This format stores multiple alignments at the DNA level between entire genomes. - The .maf format is line-oriented. Each multiple alignment ends with a blank line. - Each sequence in an alignment is on a single line. - Lines starting with # are considered to be comments. - Each multiple alignment is in a separate paragraph that begins with an "a" line and contains an "s" line for each sequence in the multiple alignment. - Some MAF files may contain two optional line types: - An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line; - An "e" line containing information about the size of the gap between the alignments that span the current block. **BED format** Browser Extensible Data format was designed at UCSC for displaying data tracks in the Genome Browser. It has three required fields and a number of additional optional ones: The first three BED fields (required) are:: 1. chrom - The name of the chromosome (e.g. chr1, chrY_random). 2. chromStart - The starting position in the chromosome. (The first base in a chromosome is numbered 0.) 3. chromEnd - The ending position in the chromosome, plus 1 (i.e., a half-open interval). Additional (optional) fields are:: 4. name - The name of the BED line. 5. score - A score between 0 and 1000. 6. strand - Defines the strand - either '+' or '-'.