[2] | 1 | <tool id="generate_coverage_report" name="Polymorphism of the Reads"> |
---|
| 2 | <description>the percentage of reads supporting each nucleotide at each location</description> |
---|
| 3 | <command interpreter="python">blat_coverage_report.py $input1 $output1</command> |
---|
| 4 | <inputs> |
---|
| 5 | <param name="input1" type="data" format="tabular" label="Alignment result"/> |
---|
| 6 | </inputs> |
---|
| 7 | <outputs> |
---|
| 8 | <data name="output1" format="tabular"/> |
---|
| 9 | </outputs> |
---|
| 10 | <tests> |
---|
| 11 | <test> |
---|
| 12 | <param name="input1" value="blat_coverage_report_test1.txt" ftype="tabular" /> |
---|
| 13 | <output name="output1" file="blat_coverage_report_test1.out" /> |
---|
| 14 | </test> |
---|
| 15 | </tests> |
---|
| 16 | <help> |
---|
| 17 | |
---|
| 18 | .. class:: warningmark |
---|
| 19 | |
---|
| 20 | **IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command). |
---|
| 21 | |
---|
| 22 | ----- |
---|
| 23 | |
---|
| 24 | **What it does** |
---|
| 25 | |
---|
| 26 | The tool will generate a table of 6 columns as following: |
---|
| 27 | |
---|
| 28 | - 1st column: chromosome id. |
---|
| 29 | |
---|
| 30 | - 2nd column: chromosome location. |
---|
| 31 | |
---|
| 32 | - 3rd column: the nucleotide from reference genome at the chromosome location (2nd column). |
---|
| 33 | |
---|
| 34 | - 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location). |
---|
| 35 | |
---|
| 36 | - 5th column: percentage of reads that support nucleotide **A** at this location. |
---|
| 37 | |
---|
| 38 | - 6th column: percentage of reads that support nucleotide **T** at this location. |
---|
| 39 | |
---|
| 40 | - 7th column: percentage of reads that support nucleotide **C** at this location. |
---|
| 41 | |
---|
| 42 | - 8th column: percentage of reads that support nucleotide **G** at this location. |
---|
| 43 | |
---|
| 44 | |
---|
| 45 | ----- |
---|
| 46 | |
---|
| 47 | **Example** |
---|
| 48 | |
---|
| 49 | - The BLAT pslx results look like the following (tab separated with sequence at the end):: |
---|
| 50 | |
---|
| 51 | 30 0 0 0 0 0 0 0 + seq0 30 0 30 chr 4639675 4549207 4549237 1 30, 0, 4549207, cggacagcgccgccaccaacaaagccacca, cggacagcgccgccaccaacaaagccacca, |
---|
| 52 | 30 0 0 0 0 0 0 0 + seq1 30 0 30 chr 4639675 614777 614807 1 30, 0, 614777, aaaacaccggatgctccggcgctggcagat, aaaacaccggatgctccggcgctggcagat, |
---|
| 53 | 28 1 0 0 0 0 0 0 + seq2 30 0 29 chr 4639675 3289283 3289312 1 29, 0, 3289283, tttgcttttagtacaccggattcagaacc, tttgctttcagtacaccggattcagaacc, |
---|
| 54 | 30 0 0 0 0 0 0 0 + seq4 30 0 30 chr 4639675 2665584 2665614 1 30, 0, 2665584, cacgctacgtgcgcccccgcccagaaggcg, cacgctacgtgcgcccccgcccagaaggcg, |
---|
| 55 | |
---|
| 56 | The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations. |
---|
| 57 | |
---|
| 58 | - The report showed overall coverage of reads on each chromosome location (partial result):: |
---|
| 59 | |
---|
| 60 | +-------+----------+------+------+--------+------+--------+------+ |
---|
| 61 | | title | location | ref. | cov. | A | T | C | G | |
---|
| 62 | +-------+----------+------+------+--------+------+--------+------+ |
---|
| 63 | | chr | 614777 | A | 1 | A(100) | T(0) | C(0) | G(0) | |
---|
| 64 | | chr | 614778 | A | 1 | A(100) | T(0) | C(0) | G(0) | |
---|
| 65 | | chr | 614779 | A | 1 | A(100) | T(0) | C(0) | G(0) | |
---|
| 66 | +-------+----------+------+------+--------+------+--------+------+ |
---|
| 67 | |
---|
| 68 | ----- |
---|
| 69 | |
---|
| 70 | **Reference** |
---|
| 71 | |
---|
| 72 | **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664. |
---|
| 73 | |
---|
| 74 | </help> |
---|
| 75 | </tool> |
---|