the percentage of reads supporting each nucleotide at each location blat_coverage_report.py $input1 $output1

.. class:: warningmark **IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command). ----- **What it does** The tool will generate a table of 6 columns as following: - 1st column: chromosome id. - 2nd column: chromosome location. - 3rd column: the nucleotide from reference genome at the chromosome location (2nd column). - 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location). - 5th column: percentage of reads that support nucleotide **A** at this location. - 6th column: percentage of reads that support nucleotide **T** at this location. - 7th column: percentage of reads that support nucleotide **C** at this location. - 8th column: percentage of reads that support nucleotide **G** at this location. ----- **Example** - The BLAT pslx results look like the following (tab separated with sequence at the end):: 30 0 0 0 0 0 0 0 + seq0 30 0 30 chr 4639675 4549207 4549237 1 30, 0, 4549207, cggacagcgccgccaccaacaaagccacca, cggacagcgccgccaccaacaaagccacca, 30 0 0 0 0 0 0 0 + seq1 30 0 30 chr 4639675 614777 614807 1 30, 0, 614777, aaaacaccggatgctccggcgctggcagat, aaaacaccggatgctccggcgctggcagat, 28 1 0 0 0 0 0 0 + seq2 30 0 29 chr 4639675 3289283 3289312 1 29, 0, 3289283, tttgcttttagtacaccggattcagaacc, tttgctttcagtacaccggattcagaacc, 30 0 0 0 0 0 0 0 + seq4 30 0 30 chr 4639675 2665584 2665614 1 30, 0, 2665584, cacgctacgtgcgcccccgcccagaaggcg, cacgctacgtgcgcccccgcccagaaggcg, The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations. - The report showed overall coverage of reads on each chromosome location (partial result):: +-------+----------+------+------+--------+------+--------+------+ | title | location | ref. | cov. | A | T | C | G | +-------+----------+------+------+--------+------+--------+------+ | chr | 614777 | A | 1 | A(100) | T(0) | C(0) | G(0) | | chr | 614778 | A | 1 | A(100) | T(0) | C(0) | G(0) | | chr | 614779 | A | 1 | A(100) | T(0) | C(0) | G(0) | +-------+----------+------+------+--------+------+--------+------+ ----- **Reference** **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664.