1 | #!/usr/bin/env python |
---|
2 | """ |
---|
3 | convert SOLiD calor-base data to nucleotide sequence |
---|
4 | example: T011213122200221123032111221021210131332222101 |
---|
5 | TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT |
---|
6 | """ |
---|
7 | |
---|
8 | import sys, os |
---|
9 | |
---|
10 | def stop_err(msg): |
---|
11 | |
---|
12 | sys.stderr.write(msg) |
---|
13 | sys.stderr.write('\n') |
---|
14 | sys.exit() |
---|
15 | |
---|
16 | def color2base(color_seq): |
---|
17 | |
---|
18 | first_nuc = ['A','C','G','T'] |
---|
19 | code_matrix = {} |
---|
20 | code_matrix['0'] = ['A','C','G','T'] |
---|
21 | code_matrix['1'] = ['C','A','T','G'] |
---|
22 | code_matrix['2'] = ['G','T','A','C'] |
---|
23 | code_matrix['3'] = ['T','G','C','A'] |
---|
24 | |
---|
25 | overlap_nuc = '' |
---|
26 | nuc_seq = '' |
---|
27 | |
---|
28 | seq_prefix = prefix = color_seq[0].upper() |
---|
29 | color_seq = color_seq[1:] |
---|
30 | |
---|
31 | if not (seq_prefix in first_nuc): |
---|
32 | stop_err('The leading nucleotide is invalid. Must be one of the four nucleotides: A, T, C, G.\nThe file contains a %s' %seq_prefix ) |
---|
33 | |
---|
34 | for code in color_seq: |
---|
35 | |
---|
36 | if not (code in ['0','1','2','3']): |
---|
37 | stop_err('Expect digits (0, 1, 2, 3) in the color-cading data. File contains numbers other than the set.\nThe file contains a %s' %code) |
---|
38 | |
---|
39 | second_nuc = code_matrix[code] |
---|
40 | overlap_nuc = second_nuc[first_nuc.index(prefix)] |
---|
41 | nuc_seq += overlap_nuc |
---|
42 | prefix = overlap_nuc |
---|
43 | |
---|
44 | return seq_prefix, nuc_seq |
---|
45 | |
---|
46 | def __main__(): |
---|
47 | |
---|
48 | infilename = sys.argv[1] |
---|
49 | keep_prefix = sys.argv[2].lower() |
---|
50 | outfilename = sys.argv[3] |
---|
51 | |
---|
52 | outfile = open(outfilename,'w') |
---|
53 | |
---|
54 | prefix = '' |
---|
55 | color_seq = '' |
---|
56 | for i, line in enumerate(file(infilename)): |
---|
57 | line = line.rstrip('\r\n') |
---|
58 | |
---|
59 | if not line: continue |
---|
60 | if line.startswith("#"): continue |
---|
61 | |
---|
62 | if line.startswith(">"): |
---|
63 | |
---|
64 | if color_seq: |
---|
65 | prefix, nuc_seq = color2base(color_seq) |
---|
66 | |
---|
67 | if keep_prefix == 'yes': |
---|
68 | nuc_seq = prefix + nuc_seq |
---|
69 | |
---|
70 | outfile.write(title+'\n') |
---|
71 | outfile.write(nuc_seq+'\n') |
---|
72 | |
---|
73 | title = line |
---|
74 | color_seq = '' |
---|
75 | else: |
---|
76 | color_seq += line |
---|
77 | |
---|
78 | if color_seq: |
---|
79 | prefix, nuc_seq = color2base(color_seq) |
---|
80 | |
---|
81 | if keep_prefix == 'yes': |
---|
82 | nuc_seq = prefix + nuc_seq |
---|
83 | |
---|
84 | outfile.write(title+'\n') |
---|
85 | outfile.write(nuc_seq+'\n') |
---|
86 | |
---|
87 | outfile.close() |
---|
88 | |
---|
89 | if __name__=='__main__': __main__() |
---|