1 | <tool id="color2nuc" name="Convert Color Space" version="1.0.0"> |
---|
2 | <description> to Nucleotides </description> |
---|
3 | <command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command> |
---|
4 | |
---|
5 | <inputs> |
---|
6 | <param name="input1" type="data" format="txt" label="SOLiD color coding file" /> |
---|
7 | <param name="input2" type="select" label="Keep prefix nucleotide"> |
---|
8 | <option value="yes">Yes</option> |
---|
9 | <option value="no">No</option> |
---|
10 | </param> |
---|
11 | </inputs> |
---|
12 | <outputs> |
---|
13 | <data name="output1" format="fasta" /> |
---|
14 | </outputs> |
---|
15 | <!-- |
---|
16 | <tests> |
---|
17 | <test> |
---|
18 | <param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" /> |
---|
19 | <param name="input2" value="no" /> |
---|
20 | <output name="output1" file="convert_SOLiD_color2nuc_test1.out" /> |
---|
21 | </test> |
---|
22 | </tests> |
---|
23 | --> |
---|
24 | <help> |
---|
25 | |
---|
26 | .. class:: warningmark |
---|
27 | |
---|
28 | The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide. |
---|
29 | |
---|
30 | ----- |
---|
31 | |
---|
32 | **What it does** |
---|
33 | |
---|
34 | This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. |
---|
35 | |
---|
36 | ----- |
---|
37 | |
---|
38 | **Example** |
---|
39 | |
---|
40 | - If the color space file looks like this:: |
---|
41 | |
---|
42 | >seq1 |
---|
43 | A013 |
---|
44 | >seq2 |
---|
45 | T011213122200221123032111221021210131332222101 |
---|
46 | |
---|
47 | - If you would like to **keep** the leading nucleotide:: |
---|
48 | |
---|
49 | >seq1 |
---|
50 | AACG |
---|
51 | >seq2 |
---|
52 | TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT |
---|
53 | |
---|
54 | - If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence):: |
---|
55 | |
---|
56 | >seq1 |
---|
57 | ACG |
---|
58 | >seq2 |
---|
59 | TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT |
---|
60 | |
---|
61 | ----- |
---|
62 | |
---|
63 | **ABI SOLiD Color Coding Alignment matrix** |
---|
64 | |
---|
65 | Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities). |
---|
66 | |
---|
67 | |
---|
68 | .. image:: ../static/images/dualcolorcode.png |
---|
69 | |
---|
70 | |
---|
71 | </help> |
---|
72 | </tool> |
---|