to Nucleotides convert_SOLiD_color2nuc.py $input1 $input2 $output1 Yes No .. class:: warningmark The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide. ----- **What it does** This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. ----- **Example** - If the color space file looks like this:: >seq1 A013 >seq2 T011213122200221123032111221021210131332222101 - If you would like to **keep** the leading nucleotide:: >seq1 AACG >seq2 TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT - If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence):: >seq1 ACG >seq2 TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT ----- **ABI SOLiD Color Coding Alignment matrix** Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities). .. image:: ../static/images/dualcolorcode.png