1 | <tool id="fastqsolexa_to_fasta_qual" name="FASTQSOLEXA-to-FASTA-QUAL" version="1.0.0"> |
---|
2 | <description>extracts sequences and quality scores from FASTQSOLEXA data</description> |
---|
3 | <command interpreter="python">fastqsolexa_to_fasta_qual.py $input1 $output1 $output2 $input1.extension</command> |
---|
4 | <inputs> |
---|
5 | <param name="input1" type="data" format="fastqsolexa" label="Fastqsolexa file"/> |
---|
6 | </inputs> |
---|
7 | <outputs> |
---|
8 | <data name="output1" format="fasta"/> |
---|
9 | <data name="output2" format="qualsolexa"/> |
---|
10 | </outputs> |
---|
11 | <tests> |
---|
12 | <!-- NOTE: this tool generates 2 output files, but our functional tests currently only handle the last one generated --> |
---|
13 | <test> |
---|
14 | <param name="input1" value="1.fastqsolexa" ftype="fastqsolexa" /> |
---|
15 | <output name="output1" file="fastqsolexa_to_fasta_qual_out4.fasta" /> |
---|
16 | </test> |
---|
17 | <test> |
---|
18 | <param name="input1" value="2.fastqsolexa" ftype="fastqsolexa" /> |
---|
19 | <output name="output1" file="fastqsolexa_to_fasta_qual_out2.fasta" /> |
---|
20 | </test> |
---|
21 | </tests> |
---|
22 | <help> |
---|
23 | |
---|
24 | .. class:: warningmark |
---|
25 | |
---|
26 | IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. |
---|
27 | |
---|
28 | ----- |
---|
29 | |
---|
30 | **What it does** |
---|
31 | |
---|
32 | This tool extracts sequences and quality scores from FASTQ data ( Solexa variant ), producing a FASTA dataset and a QUAL dataset. |
---|
33 | |
---|
34 | ----- |
---|
35 | |
---|
36 | **Example1** |
---|
37 | |
---|
38 | - Converting the following Solexa fastq data:: |
---|
39 | |
---|
40 | @seq1 |
---|
41 | GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT |
---|
42 | +seq1 |
---|
43 | hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh |
---|
44 | @seq2 |
---|
45 | GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG |
---|
46 | +seq2 |
---|
47 | hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO |
---|
48 | |
---|
49 | - will extract the following sequences:: |
---|
50 | |
---|
51 | >seq1 |
---|
52 | GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT |
---|
53 | >seq2 |
---|
54 | GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG |
---|
55 | |
---|
56 | - and quality scores:: |
---|
57 | |
---|
58 | >seq1 |
---|
59 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 0 40 40 40 40 40 40 |
---|
60 | >seq2 |
---|
61 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 33 40 40 40 40 23 40 1 40 6 40 19 9 10 7 3 40 15 |
---|
62 | |
---|
63 | **Example2** |
---|
64 | |
---|
65 | - Converting the following Solexa fastq data:: |
---|
66 | |
---|
67 | @HANNIBAL_1_FC302VTAAXX:2:1:228:167 |
---|
68 | GAATTGATCAGGACATAGGACAACTGTAGGCACCAT |
---|
69 | +HANNIBAL_1_FC302VTAAXX:2:1:228:167 |
---|
70 | 40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4 |
---|
71 | @HANNIBAL_1_FC302VTAAXX:2:1:156:340 |
---|
72 | GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG |
---|
73 | +HANNIBAL_1_FC302VTAAXX:2:1:156:340 |
---|
74 | 40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9 |
---|
75 | |
---|
76 | - will extract the following sequences:: |
---|
77 | |
---|
78 | >HANNIBAL_1_FC302VTAAXX:2:1:228:167 |
---|
79 | GAATTGATCAGGACATAGGACAACTGTAGGCACCAT |
---|
80 | >HANNIBAL_1_FC302VTAAXX:2:1:156:340 |
---|
81 | GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG |
---|
82 | |
---|
83 | - and quality scores:: |
---|
84 | |
---|
85 | >HANNIBAL_1_FC302VTAAXX:2:1:228:167 |
---|
86 | 40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4 |
---|
87 | >HANNIBAL_1_FC302VTAAXX:2:1:156:340 |
---|
88 | 40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9 |
---|
89 | |
---|
90 | </help> |
---|
91 | </tool> |
---|