megablast_xml_parser.py $input1 $output1 cElementTree

**What it does** This tool processes the XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with **-m 7** option). ----- **Output fields** This tools returns tab-delimited output with the following fields:: Description Example ----------------------------------------- ----------------- 1. Name of the query sequence Seq1 2. Length of the query sequence 30 3. Name of target sequence gnl|BL_ORD_ID|0 4. Length of target sequence 5528445 5. Alignment bit score 59.96 6. E-value 8.38112e-11 7. Start of alignment within query 1 8. End of alignment within query 30 9. Start of alignment within target 5436010 10. End of alignment within target 5436039 11. Query frame 1 12. Target frame 1 13. Number of identical bases within 29 the alignment 14. Alignment length 30 15. Aligned portion (sequence) of query CGGACAGCGCCGCCACCAACAAAGCCACCA 16. Aligned portion (sequence) of target CGGACAGCGCCGCCACCAACAAAGCCATCA 17. Midline indicating positions of ||||||||||||||||||||||||||| || matches within the alignment ------ .. class:: infomark Note that this form of output does not contain alignment identify value. However, it can be computed by dividing the number of identical bases within the alignment (Field 13) by the alignment length (Field 14) using *Text Manipulation->Compute* tool