[2] | 1 | <tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0"> |
---|
| 2 | <description>reads mapping against reference sequence </description> |
---|
| 3 | <command interpreter="python"> |
---|
| 4 | #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query |
---|
| 5 | #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size |
---|
| 6 | #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold |
---|
| 7 | #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold |
---|
| 8 | #end if# |
---|
| 9 | </command> |
---|
| 10 | <inputs> |
---|
| 11 | <page> |
---|
| 12 | <conditional name="type_of_reads"> |
---|
| 13 | <param name="single_or_paired" type="select" label="Single- or Paired-ends"> |
---|
| 14 | <option value="single">Single-end</option> |
---|
| 15 | <option value="paired">Paired-end</option> |
---|
| 16 | </param> |
---|
| 17 | <when value="single"> |
---|
| 18 | <param name="input_query" type="data" format="fastqsolexa" label="Align sequencing reads" help="No dataset? Read tip below"/> |
---|
| 19 | </when> |
---|
| 20 | <when value="paired"> |
---|
| 21 | <param name="insertion_size" type="integer" size="5" value="600" label="Insertion length between two ends" help="bp" /> |
---|
| 22 | <param name="input1" type="data" format="fastqsolexa" label="Align sequencing reads, one end" /> |
---|
| 23 | <param name="input2" type="data" format="fastqsolexa" label="and the other end" /> |
---|
| 24 | </when> |
---|
| 25 | </conditional> |
---|
| 26 | <param name="input_target" type="data" format="fasta" label="against reference" /> |
---|
| 27 | <conditional name="param"> |
---|
| 28 | <param name="skip_or_full" type="select" label="SHRiMP settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List"> |
---|
| 29 | <option value="skip">Commonly used</option> |
---|
| 30 | <option value="full">Full Parameter List</option> |
---|
| 31 | </param> |
---|
| 32 | <when value="skip" /> |
---|
| 33 | <when value="full"> |
---|
| 34 | <param name="spaced_seed" type="text" size="30" value="111111011111" label="Spaced Seed" /> |
---|
| 35 | <param name="seed_matches_per_window" type="integer" size="5" value="2" label="Seed Matches per Window" /> |
---|
| 36 | <param name="seed_hit_taboo_length" type="integer" size="5" value="4" label="Seed Hit Taboo Length" /> |
---|
| 37 | <param name="seed_generation_taboo_length" type="integer" size="5" value="0" label="Seed Generation Taboo Length" /> |
---|
| 38 | <param name="seed_window_length" type="float" size="10" value="115.0" label="Seed Window Length" help="in percentage"/> |
---|
| 39 | <param name="max_hits_per_read" type="integer" size="10" value="100" label="Maximum Hits per Read" /> |
---|
| 40 | <param name="max_read_length" type="integer" size="10" value="1000" label="Maximum Read Length" /> |
---|
| 41 | <param name="kmer" type="integer" size="10" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/> |
---|
| 42 | <param name="sw_match_value" type="integer" size="10" value="100" label="S-W Match Value" /> |
---|
| 43 | <param name="sw_mismatch_value" type="integer" size="10" value="-150" label="S-W Mismatch Value" /> |
---|
| 44 | <param name="sw_gap_open_ref" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Reference)" /> |
---|
| 45 | <param name="sw_gap_open_query" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Query)" /> |
---|
| 46 | <param name="sw_gap_ext_ref" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Reference)" /> |
---|
| 47 | <param name="sw_gap_ext_query" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Query)" /> |
---|
| 48 | <param name="sw_hit_threshold" type="float" size="10" value="68.0" label="S-W Hit Threshold" help="in percentage"/> |
---|
| 49 | </when> |
---|
| 50 | </conditional> |
---|
| 51 | </page> |
---|
| 52 | </inputs> |
---|
| 53 | <outputs> |
---|
| 54 | <data name="output1" format="tabular"/> |
---|
| 55 | <data name="output2" format="tabular"/> |
---|
| 56 | </outputs> |
---|
| 57 | <requirements> |
---|
| 58 | <requirement type="binary">rmapper-ls</requirement> |
---|
| 59 | </requirements> |
---|
| 60 | <tests> |
---|
| 61 | <test> |
---|
| 62 | <param name="single_or_paired" value="single" /> |
---|
| 63 | <param name="skip_or_full" value="skip" /> |
---|
| 64 | <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> |
---|
| 65 | <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> |
---|
| 66 | <output name="output1" file="shrimp_wrapper_test1.out1" /> |
---|
| 67 | </test> |
---|
| 68 | <!-- |
---|
| 69 | <test> |
---|
| 70 | <param name="single_or_paired" value="paired" /> |
---|
| 71 | <param name="skip_or_full" value="skip" /> |
---|
| 72 | <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" /> |
---|
| 73 | <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa" /> |
---|
| 74 | <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa" /> |
---|
| 75 | <param name="insertion_size" value="600" /> |
---|
| 76 | <output name="output1" file="shrimp_wrapper_test2.out1" /> |
---|
| 77 | </test> |
---|
| 78 | <test> |
---|
| 79 | <param name="single_or_paired" value="single" /> |
---|
| 80 | <param name="skip_or_full" value="full" /> |
---|
| 81 | <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> |
---|
| 82 | <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> |
---|
| 83 | <param name="spaced_seed" value="111111011111" /> |
---|
| 84 | <param name="seed_matches_per_window" value="2" /> |
---|
| 85 | <param name="seed_hit_taboo_length" value="4" /> |
---|
| 86 | <param name="seed_generation_taboo_length" value="0" /> |
---|
| 87 | <param name="seed_window_length" value="115.0" /> |
---|
| 88 | <param name="max_hits_per_read" value="100" /> |
---|
| 89 | <param name="max_read_length" value="1000" /> |
---|
| 90 | <param name="kmer" value="-1" /> |
---|
| 91 | <param name="sw_match_value" value="100" /> |
---|
| 92 | <param name="sw_mismatch_value" value="-150" /> |
---|
| 93 | <param name="sw_gap_open_ref" value="-400" /> |
---|
| 94 | <param name="sw_gap_open_query" value="-400" /> |
---|
| 95 | <param name="sw_gap_ext_ref" value="-70" /> |
---|
| 96 | <param name="sw_gap_ext_query" value="-70" /> |
---|
| 97 | <param name="sw_hit_threshold" value="68.0" /> |
---|
| 98 | <output name="output1" file="shrimp_wrapper_test1.out1" /> |
---|
| 99 | </test> |
---|
| 100 | <test> |
---|
| 101 | <param name="single_or_paired" value="paired" /> |
---|
| 102 | <param name="skip_or_full" value="full" /> |
---|
| 103 | <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" /> |
---|
| 104 | <param name="spaced_seed" value="111111011111" /> |
---|
| 105 | <param name="seed_matches_per_window" value="2" /> |
---|
| 106 | <param name="seed_hit_taboo_length" value="4" /> |
---|
| 107 | <param name="seed_generation_taboo_length" value="0" /> |
---|
| 108 | <param name="seed_window_length" value="115.0" /> |
---|
| 109 | <param name="max_hits_per_read" value="100" /> |
---|
| 110 | <param name="max_read_length" value="1000" /> |
---|
| 111 | <param name="kmer" value="-1" /> |
---|
| 112 | <param name="sw_match_value" value="100" /> |
---|
| 113 | <param name="sw_mismatch_value" value="-150" /> |
---|
| 114 | <param name="sw_gap_open_ref" value="-400" /> |
---|
| 115 | <param name="sw_gap_open_query" value="-400" /> |
---|
| 116 | <param name="sw_gap_ext_ref" value="-70" /> |
---|
| 117 | <param name="sw_gap_ext_query" value="-70" /> |
---|
| 118 | <param name="sw_hit_threshold" value="68.0" /> |
---|
| 119 | <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa"/> |
---|
| 120 | <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa"/> |
---|
| 121 | <param name="insertion_size" value="600" /> |
---|
| 122 | <output name="output1" file="shrimp_wrapper_test2.out1" /> |
---|
| 123 | </test> |
---|
| 124 | --> |
---|
| 125 | </tests> |
---|
| 126 | <help> |
---|
| 127 | |
---|
| 128 | .. class:: warningmark |
---|
| 129 | |
---|
| 130 | IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. Click pencil icon next to your dataset to set datatype to *fastqsolexa*. |
---|
| 131 | |
---|
| 132 | |
---|
| 133 | ----- |
---|
| 134 | |
---|
| 135 | **What it does** |
---|
| 136 | |
---|
| 137 | SHRiMP (SHort Read Mapping Package) is a software package for aligning genomic reads against a target genome. |
---|
| 138 | |
---|
| 139 | This wrapper post-processes the default SHRiMP/rmapper-ls output and generates a table with all information from reads and reference for the mapping. The tool takes single- or paired-end reads. For single-end reads, only uniquely mapped alignment is considered. In paired-end reads, only pairs that meet the following criteria will be used to generate the table: 1). the ends fall within the insertion size; 2). the ends are mapped at the opposite directions. If there are still multiple mappings after applying the criteria, this paired-end read will be discarded. |
---|
| 140 | |
---|
| 141 | |
---|
| 142 | ----- |
---|
| 143 | |
---|
| 144 | **Input formats** |
---|
| 145 | |
---|
| 146 | A multiple-fastq file, for example:: |
---|
| 147 | |
---|
| 148 | @seq1 |
---|
| 149 | TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT |
---|
| 150 | +seq1 |
---|
| 151 | hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh |
---|
| 152 | |
---|
| 153 | |
---|
| 154 | ----- |
---|
| 155 | |
---|
| 156 | **Outputs** |
---|
| 157 | |
---|
| 158 | The tool gives two outputs. |
---|
| 159 | |
---|
| 160 | **Table output** |
---|
| 161 | |
---|
| 162 | Table output contains 8 columns:: |
---|
| 163 | |
---|
| 164 | 1 2 3 4 5 6 7 8 |
---|
| 165 | ---------------------------------------------------- |
---|
| 166 | chrM 14711 seq1 0 T A 40 1 |
---|
| 167 | chrM 14712 seq1 1 T T 40 1 |
---|
| 168 | |
---|
| 169 | where:: |
---|
| 170 | |
---|
| 171 | 1. (chrM) - Reference sequence id |
---|
| 172 | 2. (14711) - Position of the mapping in the reference |
---|
| 173 | 3. (seq1) - Read id |
---|
| 174 | 4. (0) - Position of the mapping in the read |
---|
| 175 | 5. (T) - Nucleotide in the reference |
---|
| 176 | 6. (A) - Nucleotide in the read |
---|
| 177 | 7. (40) - Quality score for the nucleotide in the position of the read |
---|
| 178 | 8. (1) - The number of times this position is covered by reads |
---|
| 179 | |
---|
| 180 | |
---|
| 181 | **SHRiMP output** |
---|
| 182 | |
---|
| 183 | This is the default output from SHRiMP/rmapper-ls:: |
---|
| 184 | |
---|
| 185 | 1 2 3 4 5 6 7 8 9 10 |
---|
| 186 | ------------------------------------------------------------------- |
---|
| 187 | seq1 chrM + 3644 3679 1 36 36 3600 36 |
---|
| 188 | |
---|
| 189 | where:: |
---|
| 190 | |
---|
| 191 | 1. (seq1) - Read id |
---|
| 192 | 2. (chrM) - Reference sequence id |
---|
| 193 | 3. (+) - Strand of the read |
---|
| 194 | 4. (3466) - Start position of the alignment in the reference |
---|
| 195 | 5. (3679) - End position of the alignment in the reference |
---|
| 196 | 6. (1) - Start position of the alignment in the read |
---|
| 197 | 7. (36) - End position of the alignment in the read |
---|
| 198 | 8. (36) - Length of the read |
---|
| 199 | 9. (3600) - Score |
---|
| 200 | 10. (36) - Edit string |
---|
| 201 | |
---|
| 202 | |
---|
| 203 | ----- |
---|
| 204 | |
---|
| 205 | **SHRiMP parameter list** |
---|
| 206 | |
---|
| 207 | The commonly used parameters with default value setting:: |
---|
| 208 | |
---|
| 209 | -s Spaced Seed (default: 111111011111) |
---|
| 210 | The spaced seed is a single contiguous string of 0's and 1's. |
---|
| 211 | 0's represent wildcards, or positions which will always be |
---|
| 212 | considered as matching, whereas 1's dictate positions that |
---|
| 213 | must match. A string of all 1's will result in a simple kmer scan. |
---|
| 214 | -n Seed Matches per Window (default: 2) |
---|
| 215 | The number of seed matches per window dictates how many seeds |
---|
| 216 | must match within some window length of the genome before that |
---|
| 217 | region is considered for Smith-Waterman alignment. A lower |
---|
| 218 | value will increase sensitivity while drastically increasing |
---|
| 219 | running time. Higher values will have the opposite effect. |
---|
| 220 | -t Seed Hit Taboo Length (default: 4) |
---|
| 221 | The seed taboo length specifies how many target genome bases |
---|
| 222 | or colors must exist prior to a previous seed match in order |
---|
| 223 | to count another seed match as a hit. |
---|
| 224 | -9 Seed Generation Taboo Length (default: 0) |
---|
| 225 | |
---|
| 226 | -w Seed Window Length (default: 115.00%) |
---|
| 227 | This parameter specifies the genomic span in bases (or colours) |
---|
| 228 | in which *seed_matches_per_window* must exist before the read |
---|
| 229 | is given consideration by the Simth-Waterman alignment machinery. |
---|
| 230 | -o Maximum Hits per Read (default: 100) |
---|
| 231 | This parameter specifies how many hits to remember for each read. |
---|
| 232 | If more hits are encountered, ones with lower scores are dropped |
---|
| 233 | to make room. |
---|
| 234 | -r Maximum Read Length (default: 1000) |
---|
| 235 | This parameter specifies the maximum length of reads that will |
---|
| 236 | be encountered in the dataset. If larger reads than the default |
---|
| 237 | are used, an appropriate value must be passed to *rmapper*. |
---|
| 238 | -d Kmer Std. Deviation Limit (default: -1 [None]) |
---|
| 239 | This option permits pruning read kmers, which occur with |
---|
| 240 | frequencies greater than *kmer_std_dev_limit* standard |
---|
| 241 | deviations above the average. This can shorten running |
---|
| 242 | time at the cost of some sensitivity. |
---|
| 243 | *Note*: A negative value disables this option. |
---|
| 244 | -m S-W Match Value (default: 100) |
---|
| 245 | The value applied to matches during the Smith-Waterman score calculation. |
---|
| 246 | -i S-W Mismatch Value (default: -150) |
---|
| 247 | The value applied to mismatches during the Smith-Waterman |
---|
| 248 | score calculation. |
---|
| 249 | -g S-W Gap Open Penalty (Reference) (default: -400) |
---|
| 250 | The value applied to gap opens along the reference sequence |
---|
| 251 | during the Smith-Waterman score calculation. |
---|
| 252 | *Note*: Note that for backward compatibility, if -g is set |
---|
| 253 | and -q is not set, the gap open penalty for the query will |
---|
| 254 | be set to the same value as specified for the reference. |
---|
| 255 | -q S-W Gap Open Penalty (Query) (default: -400) |
---|
| 256 | The value applied to gap opens along the query sequence during |
---|
| 257 | the Smith-Waterman score calculation. |
---|
| 258 | -e S-W Gap Extend Penalty (Reference) (default: -70) |
---|
| 259 | The value applied to gap extends during the Smith-Waterman score calculation. |
---|
| 260 | *Note*: Note that for backward compatibility, if -e is set |
---|
| 261 | and -f is not set, the gap exten penalty for the query will |
---|
| 262 | be set to the same value as specified for the reference. |
---|
| 263 | -f S-W Gap Extend Penalty (Query) (default: -70) |
---|
| 264 | The value applied to gap extends during the Smith-Waterman score calculation. |
---|
| 265 | -h S-W Hit Threshold (default: 68.00%) |
---|
| 266 | In letter-space, this parameter determines the threshold |
---|
| 267 | score for both vectored and full Smith-Waterman alignments. |
---|
| 268 | Any values less than this quantity will be thrown away. |
---|
| 269 | *Note* This option differs slightly in meaning between letter-space and color-space. |
---|
| 270 | |
---|
| 271 | |
---|
| 272 | ----- |
---|
| 273 | |
---|
| 274 | **Reference** |
---|
| 275 | |
---|
| 276 | **SHRiMP**: Stephen M. Rumble, Michael Brudno, Phil Lacroute, Vladimir Yanovsky, Marc Fiume, Adrian Dalca. shrimp at cs dot toronto dot edu. |
---|
| 277 | |
---|
| 278 | </help> |
---|
| 279 | </tool> |
---|