reads mapping against reference sequence #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold #end if# Single-end Paired-end Commonly used Full Parameter List rmapper-ls

.. class:: warningmark IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. Click pencil icon next to your dataset to set datatype to *fastqsolexa*. ----- **What it does** SHRiMP (SHort Read Mapping Package) is a software package for aligning genomic reads against a target genome. This wrapper post-processes the default SHRiMP/rmapper-ls output and generates a table with all information from reads and reference for the mapping. The tool takes single- or paired-end reads. For single-end reads, only uniquely mapped alignment is considered. In paired-end reads, only pairs that meet the following criteria will be used to generate the table: 1). the ends fall within the insertion size; 2). the ends are mapped at the opposite directions. If there are still multiple mappings after applying the criteria, this paired-end read will be discarded. ----- **Input formats** A multiple-fastq file, for example:: @seq1 TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT +seq1 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh ----- **Outputs** The tool gives two outputs. **Table output** Table output contains 8 columns:: 1 2 3 4 5 6 7 8 ---------------------------------------------------- chrM 14711 seq1 0 T A 40 1 chrM 14712 seq1 1 T T 40 1 where:: 1. (chrM) - Reference sequence id 2. (14711) - Position of the mapping in the reference 3. (seq1) - Read id 4. (0) - Position of the mapping in the read 5. (T) - Nucleotide in the reference 6. (A) - Nucleotide in the read 7. (40) - Quality score for the nucleotide in the position of the read 8. (1) - The number of times this position is covered by reads **SHRiMP output** This is the default output from SHRiMP/rmapper-ls:: 1 2 3 4 5 6 7 8 9 10 ------------------------------------------------------------------- seq1 chrM + 3644 3679 1 36 36 3600 36 where:: 1. (seq1) - Read id 2. (chrM) - Reference sequence id 3. (+) - Strand of the read 4. (3466) - Start position of the alignment in the reference 5. (3679) - End position of the alignment in the reference 6. (1) - Start position of the alignment in the read 7. (36) - End position of the alignment in the read 8. (36) - Length of the read 9. (3600) - Score 10. (36) - Edit string ----- **SHRiMP parameter list** The commonly used parameters with default value setting:: -s Spaced Seed (default: 111111011111) The spaced seed is a single contiguous string of 0's and 1's. 0's represent wildcards, or positions which will always be considered as matching, whereas 1's dictate positions that must match. A string of all 1's will result in a simple kmer scan. -n Seed Matches per Window (default: 2) The number of seed matches per window dictates how many seeds must match within some window length of the genome before that region is considered for Smith-Waterman alignment. A lower value will increase sensitivity while drastically increasing running time. Higher values will have the opposite effect. -t Seed Hit Taboo Length (default: 4) The seed taboo length specifies how many target genome bases or colors must exist prior to a previous seed match in order to count another seed match as a hit. -9 Seed Generation Taboo Length (default: 0) -w Seed Window Length (default: 115.00%) This parameter specifies the genomic span in bases (or colours) in which *seed_matches_per_window* must exist before the read is given consideration by the Simth-Waterman alignment machinery. -o Maximum Hits per Read (default: 100) This parameter specifies how many hits to remember for each read. If more hits are encountered, ones with lower scores are dropped to make room. -r Maximum Read Length (default: 1000) This parameter specifies the maximum length of reads that will be encountered in the dataset. If larger reads than the default are used, an appropriate value must be passed to *rmapper*. -d Kmer Std. Deviation Limit (default: -1 [None]) This option permits pruning read kmers, which occur with frequencies greater than *kmer_std_dev_limit* standard deviations above the average. This can shorten running time at the cost of some sensitivity. *Note*: A negative value disables this option. -m S-W Match Value (default: 100) The value applied to matches during the Smith-Waterman score calculation. -i S-W Mismatch Value (default: -150) The value applied to mismatches during the Smith-Waterman score calculation. -g S-W Gap Open Penalty (Reference) (default: -400) The value applied to gap opens along the reference sequence during the Smith-Waterman score calculation. *Note*: Note that for backward compatibility, if -g is set and -q is not set, the gap open penalty for the query will be set to the same value as specified for the reference. -q S-W Gap Open Penalty (Query) (default: -400) The value applied to gap opens along the query sequence during the Smith-Waterman score calculation. -e S-W Gap Extend Penalty (Reference) (default: -70) The value applied to gap extends during the Smith-Waterman score calculation. *Note*: Note that for backward compatibility, if -e is set and -f is not set, the gap exten penalty for the query will be set to the same value as specified for the reference. -f S-W Gap Extend Penalty (Query) (default: -70) The value applied to gap extends during the Smith-Waterman score calculation. -h S-W Hit Threshold (default: 68.00%) In letter-space, this parameter determines the threshold score for both vectored and full Smith-Waterman alignments. Any values less than this quantity will be thrown away. *Note* This option differs slightly in meaning between letter-space and color-space. ----- **Reference** **SHRiMP**: Stephen M. Rumble, Michael Brudno, Phil Lacroute, Vladimir Yanovsky, Marc Fiume, Adrian Dalca. shrimp at cs dot toronto dot edu.