based on quality scores quality_filter.py $input $out_file1 $primary_species $mask_species $score $mask_char ${mask_region.region} #if $mask_region.region == "3" ${mask_region.lengthr},${mask_region.lengthl} #elif $mask_region.region == "0" 1 #else ${mask_region.length} #end if ${GALAXY_DATA_INDEX_DIR}/quality_scores.loc # $ ^ * ? N Only the corresponding nucleotide Corresponding column + right-side neighbors Corresponding column + left-side neighbors Corresponding column + neighbors on both sides numpy

.. class:: infomark **What it does** This tool takes a MAF file as input and filters nucleotides in every alignment block of the MAF file based on their quality/PHRED scores. ----- .. class:: warningmark **Note** Any block/s not containing the primary species (species whose quality scores is to be used), will be omitted. Also, any primary species whose quality scores are not available in Galaxy will be considered as a non-primary species. This info will appear as a message in the job history panel. ----- **Example** - For the following alignment block:: a score=4050.0 s hg18.chrX 3719221 48 - 154913754 tattttacatttaaaataaatatgtaaatatatattttatatttaaaa s panTro2.chrX 3560945 48 - 155361357 tattttatatttaaaataaagatgtaaatatatattttatatttaaaa - running this tool with **Primary species as panTro2**, **Mask species as hg18, panTro2**, **Quality cutoff as 20**, **Mask character as #** and **Mask region as only the corresponding position** will return:: a score=4050.0 s hg18.chrX 3719221 48 - 154913754 ###tttac#####a###a#atatgtaaat###tattt#####ttaaaa s panTro2.chrX 3560945 48 - 155361357 ###tttat#####a###a#agatgtaaat###tattt#####ttaaaa where, the positions containing # represent panTro2 nucleotides having quality scores less than 20.