map short paired reads against reference sequencelastz_paired_reads_wrapper.py
#if $seq_name.how_to_name=="yes":
--ref_name=$seq_name.ref_name
#else:
--ref_name="None"
#end if
--ref_source=$source.ref_source --input2=$input2 --input3=$input3 --input4=$input4
#if $source.ref_source=="history":
--input1=$source.input1
--ref_sequences=$input1.metadata.sequences
#else:
--input1=$source.input1_2bit
--ref_sequences="None"
#end if
--output=$output1 --lastz_seqs_file_dir=${GALAXY_DATA_INDEX_DIR}
lastz
**What it does**
**LASTZ** is a high performance pairwise sequence aligner derived from BLASTZ. It is written by Bob Harris in Webb Miller's laboratory at Penn State University. Special scoring sets were derived to improve runtime performance and quality. This Galaxy version of LASTZ is geared towards aligning short (Illumina/Solexa, AB/SOLiD) and medium (Roche/454) paired reads against a reference sequence. There is excellent, extensive documentation on LASTZ available here_.
.. _here: http://www.bx.psu.edu/miller_lab/dist/README.lastz-1.02.00/README.lastz-1.02.00.html
------
**Input formats**
LASTZ accepts reference and reads in FASTA format. However, because Galaxy supports implicit format conversion the tool will recognize fastq and other method specific formats.
------
**Outputs**
This LASTZ tool produces a SAM file showing sequence alignments.
**SAM output**
SAM has 12 columns::
1 2 3 4 5 6 7 8 9 10 11 12
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
HWI-EAS91_1_30788AAXX:1:2:1670:915 99 chr9 58119878 60 36M = 58120234 392 GACCCCTACCCCACCGTGCTCTGGATCTCAGTGTTT IIIIIIIIIIIIIIIIEIIIIIII7IIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36
HWI-EAS91_1_30788AAXX:1:2:1670:915 147 chr9 58120234 60 36M = 58119878 -392 ATGAGTCGAATTCTATTTTCCAAACTGTTAACAAAA IFIIDI;IIICIIIIIIIIIIIIIIIIIIIIIIIII XT:A:U NM:i:0 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:36
where::
Column Description
--------- ---------------------------------------------------------------------
1. QNAME Query (pair) NAME
2. FLAG bitwise FLAG
3. RNAME Reference sequence NAME
4. POS 1-based leftmost POSition/coordinate of clipped sequence
5. MAPQ MAPping Quality (Phred-scaled)
6. CIGAR extended CIGAR string
7. MRNM Mate Reference sequence NaMe ('=' if same as RNAME)
8. MPOS 1-based Mate POSition
9. ISIZE Inferred insert SIZE
10. SEQ query SEQuence on the same strand as the reference
11. QUAL query QUALity (ASCII-33 gives the Phred base quality)
12. OPT variable OPTional fields in the format TAG:VTYPE:VALUE, tab-separated
The flags are as follows::
Flag Description
------ -------------------------------------
0x0001 the read is paired in sequencing
0x0002 the read is mapped in a proper pair
0x0004 the query sequence itself is unmapped
0x0008 the mate is unmapped
0x0010 strand of the query (1 for reverse)
0x0020 strand of the mate
0x0040 the read is the first read in a pair
0x0080 the read is the second read in a pair
0x0100 the alignment is not primary
------
**Do you want to modify the reference name?**
This option allows you to set the name of the reference sequence manually. This is helpful when, for example, you would like to make the reference name compatible with the UCSC naming conventions to be able to display your lastz results as a custom track at the UCSC Genome Browser.
------
**LASTZ parameter list**
This is an exhaustive list of LASTZ options. Once again, please note that not all parameters are included in this interface. If you would like to make additional options available through Galaxy, e-mail us at galaxy-bugs@bx.psu.edu::
target[[s..e]][-] spec/file containing target sequence (fasta or nib)
[s..e] defines a subrange of the file
- indicates reverse-complement
(use --help=files for more details)
query[[s..e]][-] spec/file containing query sequences (fasta or nib)
if absent, queries come from stdin (unless they
aren't needed, as for --self or --tableonly)
(use --help=files for more details)
--self the target sequence is also the query
--quantum the query sequence contains quantum DNA
--seed=match<length> use a word with no gaps instead of a seed pattern
--seed=half<length> use space-free half-weight word instead of seed pattern
--match=<reward>[,<penalty>] set the score values for a match (+<reward>)
and mismatch (-<penalty>)
--[no]trans[ition][=2] allow one or two transitions in a seed hit
(by default a transition is allowed)
--word=<bits> set max bits for word hash; use this to trade time for
memory, eliminating thrashing for heavy seeds
(default is 28 bits)
--[no]filter=[<T>:]<M> filter half-weight seed hits, requiring at least M
matches and allowing no more than T transversions
(default is no filtering)
--notwins require just one seed hit
--twins=[<min>:]<maxgap> require two nearby seed hits on the same diagonal
(default is twins aren't required)
--notwins allow single, isolated seeds
--[no]recoverseeds avoid losing seeds in hash collisions. Cannot be used with --twins
--seedqueue=<entries> set number of entries in seed hit queue
(default is 262144)
--anchors=<file> read anchors from a file, instead of discovering anchors
via seeding
--recoverhits recover hash-collision seed hits
(default is not to recover seed hits)
--step=<length> set step length (default is 1)
--maxwordcount=<limit> words occurring more often than <limit> in the target
are not eligible for seeds
--strand=both search both strands
--strand=plus search + strand only (matching strand of query spec)
--strand=minus search - strand only (opposite strand of query spec)
(by default both strands are searched)
--ambiguousn treat N as an ambiguous nucleotide
(by default N is treated as a sequence splicing character)
--[no]gfextend perform gap-free extension of seed hits to HSPs
(by default no extension is performed)
--[no]chain perform chaining
--chain=<diag,anti> perform chaining with given penalties for diagonal and
anti-diagonal
(by default no chaining is performed)
--[no]gapped perform gapped alignment (instead of gap-free)
(by default gapped alignment is performed)
--score[s]=<file> read substitution scores from a file
(default is HOXD70)
--unitscore[s] scores are +1/-1 for match/mismatch
--gap=<[open,]extend> set gap open and extend penalties (default is 400,30)
--xdrop=<score> set x-drop threshold (default is 10*sub[A][A])
--ydrop=<score> set y-drop threshold (default is open+300extend)
--infer[=<control>] infer scores from the sequences, then use them
--inferonly[=<control>] infer scores, but don't use them (requires --infscores)
all inference options are read from the control file
--infscores[=<file>] write inferred scores to a file
--hspthresh=<score> set threshold for high scoring pairs (default is 3000)
ungapped extensions scoring lower are discarded
<score> can also be a percentage or base count
--entropy adjust for entropy when qualifying HSPs in the x-drop extension
method
--noentropy don't adjust for entropy when qualifying HSPs
--exact=<length> set threshold for exact matches
if specified, exact matches are found rather than high
scoring pairs (replaces --hspthresh)
--inner=<score> set threshold for HSPs during interpolation
(default is no interpolation)
--gappedthresh=<score> set threshold for gapped alignments
gapped extensions scoring lower are discarded
<score> can also be a percentage or base count
(default is to use same value as --hspthresh)
--ball=<score> set minimum score required of words 'in' a quantum ball
--[no]entropy involve entropy in filtering high scoring pairs
(default is "entropy")
--[no]mirror report/use mirror image of all gap-free alignments
(default is "mirror" for self-alignments only)
--traceback=<bytes> space for trace-back information
(default is 80.0M)
--masking=<count> mask any position in target hit this many times
zero indicates no masking
(default is no masking)
--targetcapsule=<capsule_file> the target seed word position table and seed
(as well as the target sequence)are read from specified file
--segments=<segment_file> read segments from a file, instead of discovering
them via seeding. Replaces other seeding or gap-free extension
options
--[no]census[=<file>] count/report how many times each target base aligns
(default is to not report census)
--identity=<min>[..<max>] filter alignments by percent identity
0<=min<=max<=100; blocks (or HSPs) outside min..max
are discarded
(default is no identity filtering)
--coverage=<min>[..<max>] filter alignments by percentage pf query covered
0<=min<=max<=100; blocks (or HSPs) outside min..max
are discarded
(default is no query coverage filtering)
--notrivial do not output trivial self-alignment block if the target and query
sequences are identical. Using --self enables this option automatically
--output=<output_file> write the alignments to the specified file name instead of stdout
--code=<file> give quantum code for query sequence (only for display)
--format=<type> specify output format; one of lav, axt, maf, maf+, maf-, text,
lav+text, cigar, text, rdplot, general, or general:<fields>
(by default output is LAV)
--rdotplot=<file> create an additional output file suitable for plotting the alignments
with the R statistical package.
--markend Just before normal completion, write "# lastz end-of-file" to output file
--census[=<output_file>] count and report how many times each target base aligns, up
to 255. Ns are included in the count
--census16[=<output_file>] count and report how many times each target base aligns, up
up 65 thousand
--census32[=<output_file>] count and report how many times each target bas aligns, up
to 4 billion
--writecapsule=<capsule_file> just write out a targegt capsule file and quit; don't
search for seeds or perform subsequent stages
--verbosity=<level> set info level (0 is minimum, 10 is everything)
(default is 0)
--[no]runtime report runtime in the output file
(default is to not report runtime)
--tableonly[=count] just produce the target position table, don't
search for seeds
--[no]stats[=<file>] show search statistics (or don't)
(not available in this build)
--version report the program version and quit
--help list all options
--help=files list information about file specifiers
--help=short[cuts] list blastz-compatible shortcuts
--help=yasra list yasra-specific shortcuts