@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) actgactgactgactgactgactgactgactgactgactga + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) NHBVDMKSWRYGATCnhbvdmkswrygatc + ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I