| 1 | """ |
|---|
| 2 | Support for reading and writing the `AXT`_ format used for pairwise |
|---|
| 3 | alignments. |
|---|
| 4 | |
|---|
| 5 | .. _AXT: http://genome.ucsc.edu/goldenPath/help/axt.html |
|---|
| 6 | """ |
|---|
| 7 | |
|---|
| 8 | from bx.align import * |
|---|
| 9 | |
|---|
| 10 | import itertools |
|---|
| 11 | from bx import interval_index_file |
|---|
| 12 | |
|---|
| 13 | # Tools for dealing with pairwise alignments in AXT format |
|---|
| 14 | |
|---|
| 15 | class MultiIndexed( object ): |
|---|
| 16 | """Similar to 'indexed' but wraps more than one axt_file""" |
|---|
| 17 | def __init__( self, axt_filenames, keep_open=False ): |
|---|
| 18 | self.indexes = [ Indexed( axt_file, axt_file + ".index" ) for axt_file in axt_filenames ] |
|---|
| 19 | def get( self, src, start, end ): |
|---|
| 20 | blocks = [] |
|---|
| 21 | for index in self.indexes: blocks += index.get( src, start, end ) |
|---|
| 22 | return blocks |
|---|
| 23 | |
|---|
| 24 | |
|---|
| 25 | class Indexed( object ): |
|---|
| 26 | """Indexed access to a axt using overlap queries, requires an index file""" |
|---|
| 27 | |
|---|
| 28 | def __init__( self, axt_filename, index_filename=None, keep_open=False, species1 = None, species2=None, species_to_lengths=None, support_ids=False ): |
|---|
| 29 | if index_filename is None: index_filename = axt_filename + ".index" |
|---|
| 30 | self.indexes = interval_index_file.Indexes( filename=index_filename ) |
|---|
| 31 | self.axt_filename = axt_filename |
|---|
| 32 | # nota bene: (self.species1 = species1 or "species1") is incorrect if species1="" |
|---|
| 33 | self.species1 = species1 |
|---|
| 34 | if (self.species1 == None): self.species1 = "species1" |
|---|
| 35 | self.species2 = species2 |
|---|
| 36 | if (self.species2 == None): self.species2 = "species2" |
|---|
| 37 | self.species_to_lengths = species_to_lengths |
|---|
| 38 | self.support_ids = support_ids # for extra text at end of axt header lines |
|---|
| 39 | if keep_open: |
|---|
| 40 | self.f = open( axt_filename ) |
|---|
| 41 | else: |
|---|
| 42 | self.f = None |
|---|
| 43 | |
|---|
| 44 | def get( self, src, start, end ): |
|---|
| 45 | intersections = self.indexes.find( src, start, end ) |
|---|
| 46 | return itertools.imap( self.get_axt_at_offset, [ val for start, end, val in intersections ] ) |
|---|
| 47 | |
|---|
| 48 | def get_axt_at_offset( self, offset ): |
|---|
| 49 | if self.f: |
|---|
| 50 | self.f.seek( offset ) |
|---|
| 51 | return read_next_axt( self.f, self.species1, self.species2, self.species_to_lengths, self.support_ids ) |
|---|
| 52 | else: |
|---|
| 53 | f = open( self.axt_filename ) |
|---|
| 54 | try: |
|---|
| 55 | f.seek( offset ) |
|---|
| 56 | return read_next_axt( f, self.species1, self.species2, self.species_to_lengths, self.support_ids ) |
|---|
| 57 | finally: |
|---|
| 58 | f.close() |
|---|
| 59 | |
|---|
| 60 | class Reader( object ): |
|---|
| 61 | """Iterate over all axt blocks in a file in order""" |
|---|
| 62 | |
|---|
| 63 | def __init__( self, file, species1 = None, species2=None, species_to_lengths=None, support_ids=False ): |
|---|
| 64 | self.file = file |
|---|
| 65 | # nota bene: (self.species1 = species1 or "species1") is incorrect if species1="" |
|---|
| 66 | self.species1 = species1 |
|---|
| 67 | if (self.species1 == None): self.species1 = "species1" |
|---|
| 68 | self.species2 = species2 |
|---|
| 69 | if (self.species2 == None): self.species2 = "species2" |
|---|
| 70 | self.species_to_lengths = species_to_lengths |
|---|
| 71 | self.support_ids = support_ids # for extra text at end of axt header lines |
|---|
| 72 | self.attributes = {} |
|---|
| 73 | |
|---|
| 74 | def next( self ): |
|---|
| 75 | return read_next_axt( self.file, self.species1, self.species2, self.species_to_lengths, self.support_ids ) |
|---|
| 76 | |
|---|
| 77 | def __iter__( self ): |
|---|
| 78 | return ReaderIter( self ) |
|---|
| 79 | |
|---|
| 80 | def close( self ): |
|---|
| 81 | self.file.close() |
|---|
| 82 | |
|---|
| 83 | class ReaderIter( object ): |
|---|
| 84 | def __init__( self, reader ): |
|---|
| 85 | self.reader = reader |
|---|
| 86 | def __iter__( self ): |
|---|
| 87 | return self |
|---|
| 88 | def next( self ): |
|---|
| 89 | v = self.reader.next() |
|---|
| 90 | if not v: raise StopIteration |
|---|
| 91 | return v |
|---|
| 92 | |
|---|
| 93 | class Writer( object ): |
|---|
| 94 | |
|---|
| 95 | def __init__( self, file, attributes={} ): |
|---|
| 96 | self.file = file |
|---|
| 97 | self.block = 0 |
|---|
| 98 | self.src_split = True |
|---|
| 99 | if ("src_split" in attributes): |
|---|
| 100 | self.src_split = attributes["src_split"] |
|---|
| 101 | |
|---|
| 102 | def write( self, alignment ): |
|---|
| 103 | if (len(alignment.components) != 2): |
|---|
| 104 | raise "%d-component alignment is not compatible with axt" % \ |
|---|
| 105 | len(alignment.components) |
|---|
| 106 | c1 = alignment.components[0] |
|---|
| 107 | c2 = alignment.components[1] |
|---|
| 108 | |
|---|
| 109 | if c1.strand != "+": |
|---|
| 110 | c1 = c1.reverse_complement() |
|---|
| 111 | c2 = c2.reverse_complement() |
|---|
| 112 | |
|---|
| 113 | if (self.src_split): |
|---|
| 114 | spec1,chr1 = src_split( c1.src ) |
|---|
| 115 | spec2,chr2 = src_split( c2.src ) |
|---|
| 116 | else: |
|---|
| 117 | chr1,chr2 = c1.src,c2.src |
|---|
| 118 | |
|---|
| 119 | self.file.write( "%d %s %d %d %s %d %d %s %s\n" % \ |
|---|
| 120 | (self.block,chr1,c1.start+1,c1.start+c1.size, |
|---|
| 121 | chr2,c2.start+1,c2.start+c2.size,c2.strand, |
|---|
| 122 | alignment.score)) |
|---|
| 123 | self.file.write( "%s\n" % c1.text ) |
|---|
| 124 | self.file.write( "%s\n" % c2.text ) |
|---|
| 125 | self.file.write( "\n" ) |
|---|
| 126 | self.block += 1 |
|---|
| 127 | |
|---|
| 128 | def close( self ): |
|---|
| 129 | self.file.close() |
|---|
| 130 | |
|---|
| 131 | # ---- Helper methods --------------------------------------------------------- |
|---|
| 132 | |
|---|
| 133 | # typical axt block: |
|---|
| 134 | # 0 chr19 3001012 3001075 chr11 70568380 70568443 - 3500 [optional text] |
|---|
| 135 | # TCAGCTCATAAATCACCTCCTGCCACAAGCCTGGCCTGGTCCCAGGAGAGTGTCCAGGCTCAGA |
|---|
| 136 | # TCTGTTCATAAACCACCTGCCATGACAAGCCTGGCCTGTTCCCAAGACAATGTCCAGGCTCAGA |
|---|
| 137 | # start and stop are origin-1, inclusive |
|---|
| 138 | # first species is always on plus strand |
|---|
| 139 | # when second species is on minus strand, start and stop are counted from sequence end |
|---|
| 140 | |
|---|
| 141 | def read_next_axt( file, species1, species2, species_to_lengths=None, support_ids=False ): |
|---|
| 142 | line = readline( file, skip_blank=True ) |
|---|
| 143 | if not line: return |
|---|
| 144 | fields = line.split() |
|---|
| 145 | if (len(fields) < 9) or ((not support_ids) and (len(fields) > 9)): |
|---|
| 146 | raise "bad axt-block header: %s" % line |
|---|
| 147 | attributes = {} |
|---|
| 148 | if (len(fields) > 9): |
|---|
| 149 | attributes["id"] = "_".join(fields[9:]) |
|---|
| 150 | seq1 = readline( file ) |
|---|
| 151 | if not line or line.isspace(): raise "incomplete axt-block; header: %s" % line |
|---|
| 152 | seq2 = readline( file ) |
|---|
| 153 | if not line or line.isspace(): raise "incomplete axt-block; header: %s" % line |
|---|
| 154 | # Build 2 component alignment |
|---|
| 155 | alignment = Alignment(attributes=attributes,species_to_lengths=species_to_lengths) |
|---|
| 156 | # Build component for species 1 |
|---|
| 157 | component = Component() |
|---|
| 158 | component.src = fields[1] |
|---|
| 159 | if (species1 != ""): component.src = species1 + "." + component.src |
|---|
| 160 | component.start = int( fields[2] ) - 1 # (axt intervals are origin-1 |
|---|
| 161 | end = int( fields[3] ) # and inclusive on both ends) |
|---|
| 162 | component.size = end - component.start |
|---|
| 163 | component.strand = "+" |
|---|
| 164 | component.text = seq1.strip() |
|---|
| 165 | alignment.add_component( component ) |
|---|
| 166 | # Build component for species 2 |
|---|
| 167 | component = Component() |
|---|
| 168 | component.src = fields[4] |
|---|
| 169 | if (species2 != ""): component.src = species2 + "." + component.src |
|---|
| 170 | component.start = int( fields[5] ) - 1 |
|---|
| 171 | end = int( fields[6] ) |
|---|
| 172 | component.size = end - component.start |
|---|
| 173 | component.strand = fields[7] |
|---|
| 174 | component.text = seq2.strip() |
|---|
| 175 | alignment.add_component( component ) |
|---|
| 176 | # add score |
|---|
| 177 | try: |
|---|
| 178 | alignment.score = int( fields[8] ) |
|---|
| 179 | except: |
|---|
| 180 | try: |
|---|
| 181 | alignment.score = float( fields[8] ) |
|---|
| 182 | except: |
|---|
| 183 | alignment.score = fields[8] |
|---|
| 184 | return alignment |
|---|
| 185 | |
|---|
| 186 | def readline( file, skip_blank=False ): |
|---|
| 187 | """Read a line from provided file, skipping any blank or comment lines""" |
|---|
| 188 | while 1: |
|---|
| 189 | line = file.readline() |
|---|
| 190 | if not line: return None |
|---|
| 191 | if line[0] != '#' and not ( skip_blank and line.isspace() ): |
|---|
| 192 | return line |
|---|
| 193 | |
|---|