1 | @FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) |
---|
2 | TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
---|
3 | + |
---|
4 | IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! |
---|
5 | @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) |
---|
6 | cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc |
---|
7 | + |
---|
8 | IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! |
---|
9 | @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) |
---|
10 | actgactgactgactgactgactgactgactgactgactga |
---|
11 | + |
---|
12 | IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! |
---|
13 | @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) |
---|
14 | NHBVDMKSWRYGATCnhbvdmkswrygatc |
---|
15 | + |
---|
16 | ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I |
---|