| 1 | @FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) |
|---|
| 2 | TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT |
|---|
| 3 | + |
|---|
| 4 | IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! |
|---|
| 5 | @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) |
|---|
| 6 | cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc |
|---|
| 7 | + |
|---|
| 8 | IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! |
|---|
| 9 | @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) |
|---|
| 10 | actgactgactgactgactgactgactgactgactgactga |
|---|
| 11 | + |
|---|
| 12 | IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! |
|---|
| 13 | @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) |
|---|
| 14 | NHBVDMKSWRYGATCnhbvdmkswrygatc |
|---|
| 15 | + |
|---|
| 16 | ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I |
|---|