| 1 | <tool id="fasta_compute_length" name="Compute sequence length"> |
|---|
| 2 | <description></description> |
|---|
| 3 | <command interpreter="python">fasta_compute_length.py $input $output $keep_first</command> |
|---|
| 4 | <inputs> |
|---|
| 5 | <param name="input" type="data" format="fasta" label="Compute length for these sequences"/> |
|---|
| 6 | <param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="'0' = keep the whole thing"/> |
|---|
| 7 | </inputs> |
|---|
| 8 | <outputs> |
|---|
| 9 | <data name="output" format="tabular"/> |
|---|
| 10 | </outputs> |
|---|
| 11 | <tests> |
|---|
| 12 | <test> |
|---|
| 13 | <param name="input" value="454.fasta" /> |
|---|
| 14 | <param name="keep_first" value="0"/> |
|---|
| 15 | <output name="output" file="fasta_tool_compute_length_1.out" /> |
|---|
| 16 | </test> |
|---|
| 17 | |
|---|
| 18 | <test> |
|---|
| 19 | <param name="input" value="extract_genomic_dna_out1.fasta" /> |
|---|
| 20 | <param name="keep_first" value="0"/> |
|---|
| 21 | <output name="output" file="fasta_tool_compute_length_2.out" /> |
|---|
| 22 | </test> |
|---|
| 23 | |
|---|
| 24 | <test> |
|---|
| 25 | <param name="input" value="454.fasta" /> |
|---|
| 26 | <param name="keep_first" value="14"/> |
|---|
| 27 | <output name="output" file="fasta_tool_compute_length_3.out" /> |
|---|
| 28 | </test> |
|---|
| 29 | </tests> |
|---|
| 30 | <help> |
|---|
| 31 | |
|---|
| 32 | **What it does** |
|---|
| 33 | |
|---|
| 34 | This tool counts the length of each fasta sequence in the file. The output file has two columns per line (separated by tab): fasta titles and lengths of the sequences. The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. |
|---|
| 35 | |
|---|
| 36 | ----- |
|---|
| 37 | |
|---|
| 38 | **Example** |
|---|
| 39 | |
|---|
| 40 | Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: |
|---|
| 41 | |
|---|
| 42 | >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
>EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAAfa |
|---|
| 43 | |
|---|
| 44 | Running this tool while setting **How many characters to keep?** to **14** will produce this:: |
|---|
| 45 | |
|---|
| 46 | EYKX4VC02EQLO5 108 |
|---|
| 47 | EYKX4VC02D4GS2 60 |
|---|
| 48 | |
|---|
| 49 | |
|---|
| 50 | </help> |
|---|
| 51 | </tool> |
|---|