root/galaxy-central/tools/fasta_tools/tabular_to_fasta.xml @ 2

<tool id="tab2fasta" name="Tabular-to-FASTA" version="1.1.0">
        <description>converts tabular file to FASTA format</description>
        <command interpreter="python">tabular_to_fasta.py $input $title_col $seq_col $output </command>
        <inputs>
                <param name="input" type="data" format="tabular" label="Tab-delimited file"/>
                <param name="title_col" type="data_column" data_ref="input" multiple="True" numerical="False" label="Title column(s)" help="Multi-select list - hold the appropriate key while clicking to select multiple columns"/>
                <param name="seq_col" type="data_column" data_ref="input" numerical="False" label="Sequence column" />
        </inputs>
        <outputs>
                <data name="output" format="fasta"/>
        </outputs>
        <tests>
                <test>
                        <param name="input" value="solexa.tabular" />
                        <param name="title_col" value="1,2,3,4" />
                        <param name="seq_col" value="5" />
                        <output name="output" file="tabular_to_fasta_out1.fasta" />
                </test>
        </tests>
        <help>
        
**What it does**

Converts tab delimited data into FASTA formatted sequences.

-----------
        
**Example**

Suppose this is a sequence file produced by Illumina (Solexa) sequencer::

        5       300     902     419     GACTCATGATTTCTTACCTATTAGTGGTTGAACATC
        5       300     880     431     GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT
        
Selecting **c3** and **c4** as the **Title column(s)** and **c5** as the **Sequence column** will result in::

        &gt;902_419
        GACTCATGATTTCTTACCTATTAGTGGTTGAACATC
        &gt;880_431
        GTGATATGTATGTTGACGGCCATAAGGCTGCTTCTT
        
        </help>
</tool>