1 | <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0"> |
---|
2 | <description>on joined paired end reads</description> |
---|
3 | <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command> |
---|
4 | <inputs> |
---|
5 | <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" /> |
---|
6 | </inputs> |
---|
7 | <outputs> |
---|
8 | <data name="output1_file" format="input" /> |
---|
9 | <data name="output2_file" format="input" /> |
---|
10 | </outputs> |
---|
11 | <tests> |
---|
12 | <test> |
---|
13 | <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" /> |
---|
14 | <output name="output1_file" file="split_pair_reads_1.fastqsanger" /> |
---|
15 | <output name="output2_file" file="split_pair_reads_2.fastqsanger" /> |
---|
16 | </test> |
---|
17 | </tests> |
---|
18 | <help> |
---|
19 | **What it does** |
---|
20 | |
---|
21 | Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length. |
---|
22 | |
---|
23 | Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively. |
---|
24 | |
---|
25 | ----- |
---|
26 | |
---|
27 | **Input format** |
---|
28 | |
---|
29 | A multiple-fastq file, for example:: |
---|
30 | |
---|
31 | @HWI-EAS91_1_30788AAXX:7:21:1542:1758 |
---|
32 | GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA |
---|
33 | +HWI-EAS91_1_30788AAXX:7:21:1542:1758 |
---|
34 | hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR |
---|
35 | |
---|
36 | |
---|
37 | ----- |
---|
38 | |
---|
39 | **Outputs** |
---|
40 | |
---|
41 | Left-hand Read:: |
---|
42 | |
---|
43 | @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 |
---|
44 | GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC |
---|
45 | +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 |
---|
46 | hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh |
---|
47 | |
---|
48 | Right-hand Read:: |
---|
49 | |
---|
50 | @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 |
---|
51 | GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA |
---|
52 | +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 |
---|
53 | hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR |
---|
54 | |
---|
55 | </help> |
---|
56 | </tool> |
---|