root/galaxy-central/tools/fastx_toolkit/fastq_to_fasta.xml

<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
        <description>converter</description>
        <requirements><requirement type="package">fastx_toolkit</requirement></requirements>
        <command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v </command>

        <inputs>
                <param format="fastq" name="input" type="data" label="FASTQ Library to convert" />

                <param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
                        <option value="">yes</option>
                        <option value="-n">no</option>
                </param>

                <param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
                        <option value="-r">yes</option>
                        <option value="">no</option>
                </param>

        </inputs>

        <tests>
                <test>
                        <!-- FASTQ-To-FASTA, keep N, don't rename -->
                        <param name="input" value="fastq_to_fasta1.fastq" />
                        <param name="SKIPN" value=""/>
                        <param name="RENAMESEQ" value=""/>
                        <output name="output" file="fastq_to_fasta1a.out" />
                </test>
                <test>
                        <!-- FASTQ-To-FASTA, discard N, rename -->
                        <param name="input" value="fastq_to_fasta1.fastq" />
                        <param name="SKIPN" value="no"/>
                        <param name="RENAMESEQ" value="yes"/>
                        <output name="output" file="fastq_to_fasta1b.out" />
                </test>
        </tests>

        <outputs>
                <data format="fasta" name="output" metadata_source="input" />
        </outputs>

<help>

**What it does**

This tool converts data from Solexa format to FASTA format (scroll down for format description).

--------

**Example**

The following data in Solexa-FASTQ format::

    @CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +CSHL_4_FC042GAMMII_2_1_517_596
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
  
Will be converted to FASTA (with 'rename sequence names' = NO)::

    >CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    
Will be converted to FASTA (with 'rename sequence names' = YES)::

    >1
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    
------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/    
</help>
</tool>
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->