1 | <tool id="generate_coverage_report" name="Polymorphism of the Reads"> |
---|
2 | <description>the percentage of reads supporting each nucleotide at each location</description> |
---|
3 | <command interpreter="python">blat_coverage_report.py $input1 $output1</command> |
---|
4 | <inputs> |
---|
5 | <param name="input1" type="data" format="tabular" label="Alignment result"/> |
---|
6 | </inputs> |
---|
7 | <outputs> |
---|
8 | <data name="output1" format="tabular"/> |
---|
9 | </outputs> |
---|
10 | <tests> |
---|
11 | <test> |
---|
12 | <param name="input1" value="blat_coverage_report_test1.txt" ftype="tabular" /> |
---|
13 | <output name="output1" file="blat_coverage_report_test1.out" /> |
---|
14 | </test> |
---|
15 | </tests> |
---|
16 | <help> |
---|
17 | |
---|
18 | .. class:: warningmark |
---|
19 | |
---|
20 | **IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command). |
---|
21 | |
---|
22 | ----- |
---|
23 | |
---|
24 | **What it does** |
---|
25 | |
---|
26 | The tool will generate a table of 6 columns as following: |
---|
27 | |
---|
28 | - 1st column: chromosome id. |
---|
29 | |
---|
30 | - 2nd column: chromosome location. |
---|
31 | |
---|
32 | - 3rd column: the nucleotide from reference genome at the chromosome location (2nd column). |
---|
33 | |
---|
34 | - 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location). |
---|
35 | |
---|
36 | - 5th column: percentage of reads that support nucleotide **A** at this location. |
---|
37 | |
---|
38 | - 6th column: percentage of reads that support nucleotide **T** at this location. |
---|
39 | |
---|
40 | - 7th column: percentage of reads that support nucleotide **C** at this location. |
---|
41 | |
---|
42 | - 8th column: percentage of reads that support nucleotide **G** at this location. |
---|
43 | |
---|
44 | |
---|
45 | ----- |
---|
46 | |
---|
47 | **Example** |
---|
48 | |
---|
49 | - The BLAT pslx results look like the following (tab separated with sequence at the end):: |
---|
50 | |
---|
51 | 30 0 0 0 0 0 0 0 + seq0 30 0 30 chr 4639675 4549207 4549237 1 30, 0, 4549207, cggacagcgccgccaccaacaaagccacca, cggacagcgccgccaccaacaaagccacca, |
---|
52 | 30 0 0 0 0 0 0 0 + seq1 30 0 30 chr 4639675 614777 614807 1 30, 0, 614777, aaaacaccggatgctccggcgctggcagat, aaaacaccggatgctccggcgctggcagat, |
---|
53 | 28 1 0 0 0 0 0 0 + seq2 30 0 29 chr 4639675 3289283 3289312 1 29, 0, 3289283, tttgcttttagtacaccggattcagaacc, tttgctttcagtacaccggattcagaacc, |
---|
54 | 30 0 0 0 0 0 0 0 + seq4 30 0 30 chr 4639675 2665584 2665614 1 30, 0, 2665584, cacgctacgtgcgcccccgcccagaaggcg, cacgctacgtgcgcccccgcccagaaggcg, |
---|
55 | |
---|
56 | The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations. |
---|
57 | |
---|
58 | - The report showed overall coverage of reads on each chromosome location (partial result):: |
---|
59 | |
---|
60 | +-------+----------+------+------+--------+------+--------+------+ |
---|
61 | | title | location | ref. | cov. | A | T | C | G | |
---|
62 | +-------+----------+------+------+--------+------+--------+------+ |
---|
63 | | chr | 614777 | A | 1 | A(100) | T(0) | C(0) | G(0) | |
---|
64 | | chr | 614778 | A | 1 | A(100) | T(0) | C(0) | G(0) | |
---|
65 | | chr | 614779 | A | 1 | A(100) | T(0) | C(0) | G(0) | |
---|
66 | +-------+----------+------+------+--------+------+--------+------+ |
---|
67 | |
---|
68 | ----- |
---|
69 | |
---|
70 | **Reference** |
---|
71 | |
---|
72 | **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664. |
---|
73 | |
---|
74 | </help> |
---|
75 | </tool> |
---|