root/galaxy-central/tools/ngs_rna/cufflinks_wrapper.xml @ 3

リビジョン 2, 11.5 KB (コミッタ: hatakeyama, 16 年 前)

import galaxy-central

行番号 
1<tool id="cufflinks" name="Cufflinks" version="0.9.1">
2    <description>transcript assembly and FPKM (RPKM) estimates for RNA-Seq data</description>
3    <requirements>
4        <requirement type="package">cufflinks</requirement>
5    </requirements>
6    <command interpreter="python">
7        cufflinks_wrapper.py
8            --input=$input
9            --assembled-isoforms-output=$assembled_isoforms
10            --transcripts-expression-output=$transcripts_expression
11            --genes-expression-output=$genes_expression
12            --num-threads="4"
13            -I $max_intron_len
14            -F $min_isoform_fraction
15            -j $pre_mrna_fraction
16            -Q $min_map_quality
17            #if $reference_annotation.use_ref == "Yes":
18                -G $reference_annotation.reference_annotation_file
19            #end if
20            #if $singlePaired.sPaired == "paired":
21                -m $singlePaired.mean_inner_distance
22                -s $singlePaired.inner_distance_std_dev
23            #end if
24    </command>
25    <inputs>
26        <param format="sam" name="input" type="data" label="SAM file of aligned RNA-Seq reads" help=""/>
27        <param name="max_intron_len" type="integer" value="300000" label="Max Intron Length" help=""/>
28        <param name="min_isoform_fraction" type="float" value="0.05" label="Min Isoform Fraction" help=""/>
29        <param name="pre_mrna_fraction" type="float" value="0.05" label="Pre MRNA Fraction" help=""/>
30        <param name="min_map_quality" type="integer" value="0" label="Min SAM Map Quality" help=""/>
31        <conditional name="reference_annotation">
32            <param name="use_ref" type="select" label="Use Reference Annotation?">
33                <option value="No">No</option>
34                <option value="Yes">Yes</option>
35            </param>
36            <when value="No"></when>
37            <when value="Yes">
38                <param format="gtf" name="reference_annotation_file" type="data" label="Reference Annotation" help="Make sure your annotation file is in GTF format and that Galaxy knows that your file is GTF--not GFF."/>
39            </when>
40        </conditional>
41        <conditional name="singlePaired">
42            <param name="sPaired" type="select" label="Is this library mate-paired?">
43                <option value="single">Single-end</option>
44                <option value="paired">Paired-end</option>
45            </param>
46            <when value="single"></when>
47            <when value="paired">
48                <param name="mean_inner_distance" type="integer" value="20" label="Mean Inner Distance between Mate Pairs"/>
49                <param name="inner_distance_std_dev" type="integer" value="20" label="Standard Deviation for Inner Distance between Mate Pairs"/>
50            </when>
51        </conditional>
52       
53    </inputs>
54
55    <outputs>
56        <data format="tabular" name="genes_expression" label="${tool.name} on ${on_string}: gene expression"/>
57        <data format="tabular" name="transcripts_expression" label="${tool.name} on ${on_string}: transcript expression"/>
58        <data format="gtf" name="assembled_isoforms" label="${tool.name} on ${on_string}: assembled transcripts"/>
59    </outputs>
60
61    <tests>
62        <!--
63            Simple test that uses test data included with cufflinks.
64        -->
65        <test>
66            <param name="sPaired" value="single"/>
67            <param name="input" value="cufflinks_in.sam"/>
68            <param name="mean_inner_distance" value="20"/>
69            <param name="max_intron_len" value="300000"/>
70            <param name="min_isoform_fraction" value="0.05"/>
71            <param name="pre_mrna_fraction" value="0.05"/>
72            <param name="min_map_quality" value="0"/>
73            <param name="use_ref" value="No"/>
74            <output name="genes_expression" format="tabular" file="cufflinks_out3.expr"/>
75            <output name="transcripts_expression" format="tabular" file="cufflinks_out2.expr"/>
76            <output name="assembled_isoforms" file="cufflinks_out1.gtf"/>
77        </test>
78    </tests>
79
80    <help>
81**Cufflinks Overview**
82
83Cufflinks_ assembles transcripts, estimates their abundances, and tests for differential expression and regulation in RNA-Seq samples. It accepts aligned RNA-Seq reads and assembles the alignments into a parsimonious set of transcripts. Cufflinks then estimates the relative abundances of these transcripts based on how many reads support each one.  Please cite: Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L. Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nature Biotechnology doi:10.1038/nbt.1621
84
85.. _Cufflinks: http://cufflinks.cbcb.umd.edu/
86       
87------
88
89**Know what you are doing**
90
91.. class:: warningmark
92
93There is no such thing (yet) as an automated gearshift in expression analysis. It is all like stick-shift driving in San Francisco. In other words, running this tool with default parameters will probably not give you meaningful results. A way to deal with this is to **understand** the parameters by carefully reading the `documentation`__ and experimenting. Fortunately, Galaxy makes experimenting easy.
94
95.. __: http://cufflinks.cbcb.umd.edu/manual.html
96
97------
98
99**Input formats**
100
101Cufflinks takes a text file of SAM alignments as input. The RNA-Seq read mapper TopHat produces output in this format, and is recommended for use with Cufflinks. However Cufflinks will accept SAM alignments generated by any read mapper. Here's an example of an alignment Cufflinks will accept::
102
103  s6.25mer.txt-913508   16      chr1 4482736 255 14M431N11M * 0 0 \
104     CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:-
105       
106Note the use of the custom tag XS. This attribute, which must have a value of "+" or "-", indicates which strand the RNA that produced this read came from. While this tag can be applied to any alignment, including unspliced ones, it must be present for all spliced alignment records (those with a 'N' operation in the CIGAR string).
107The SAM file supplied to Cufflinks must be sorted by reference position. If you aligned your reads with TopHat, your alignments will be properly sorted already. If you used another tool, you may want to make sure they are properly sorted as follows::
108
109  sort -k 3,3 -k 4,4n hits.sam > hits.sam.sorted
110
111NOTE: Cufflinks currently only supports SAM alignments with the CIGAR match ('M') and reference skip ('N') operations. Support for the other operations, such as insertions, deletions, and clipping, will be added in the future.
112
113------
114
115**Outputs**
116
117Cufflinks produces three output files:
118
119Transcripts and Genes:
120
121This GTF file contains Cufflinks' assembled isoforms. The first 7 columns are standard GTF, and the last column contains attributes, some of which are also standardized (e.g. gene_id, transcript_id). There one GTF record per row, and each record represents either a transcript or an exon within a transcript. The columns are defined as follows::
122
123  Column number   Column name   Example     Description
124  -----------------------------------------------------
125  1               seqname       chrX        Chromosome or contig name
126  2               source        Cufflinks   The name of the program that generated this file (always 'Cufflinks')
127  3               feature       exon        The type of record (always either "transcript" or "exon").
128  4               start         77696957    The leftmost coordinate of this record (where 0 is the leftmost possible coordinate)
129  5               end           77712009    The rightmost coordinate of this record, inclusive.
130  6               score         77712009    The most abundant isoform for each gene is assigned a score of 1000. Minor isoforms are scored by the ratio (minor FPKM/major FPKM)
131  7               strand        +           Cufflinks' guess for which strand the isoform came from. Always one of '+', '-' '.'
132  7               frame         .           Cufflinks does not predict where the start and stop codons (if any) are located within each transcript, so this field is not used.
133  8               attributes    See below
134 
135Each GTF record is decorated with the following attributes::
136
137  Attribute       Example       Description
138  -----------------------------------------
139  gene_id         CUFF.1        Cufflinks gene id
140  transcript_id   CUFF.1.1      Cufflinks transcript id
141  FPKM            101.267       Isoform-level relative abundance in Reads Per Kilobase of exon model per Million mapped reads
142  frac            0.7647        Reserved. Please ignore, as this attribute may be deprecated in the future
143  conf_lo         0.07          Lower bound of the 95% confidence interval of the abundance of this isoform, as a fraction of the isoform abundance. That is, lower bound = FPKM * (1.0 - conf_lo)
144  conf_hi         0.1102        Upper bound of the 95% confidence interval of the abundance of this isoform, as a fraction of the isoform abundance. That is, upper bound = FPKM * (1.0 + conf_lo)
145  cov             100.765       Estimate for the absolute depth of read coverage across the whole transcript
146 
147
148Transcripts only:
149  This file is simply a tab delimited file containing one row per transcript and with columns containing the attributes above. There are a few additional attributes not in the table above, but these are reserved for debugging, and may change or disappear in the future.
150   
151Genes only:
152This file contains gene-level coordinates and expression values.
153   
154-------
155
156**Cufflinks settings**
157
158All of the options have a default value. You can change any of them. Most of the options in Cufflinks have been implemented here.
159
160------
161
162**Cufflinks parameter list**
163
164This is a list of implemented Cufflinks options::
165
166  -m INT    This is the expected (mean) inner distance between mate pairs. For, example, for paired end runs with fragments selected at 300bp, where each end is 50bp, you should set -r to be 200. The default is 45bp.
167  -s INT    The standard deviation for the distribution on inner distances between mate pairs. The default is 20bp.
168  -I INT    The minimum intron length. Cufflinks will not report transcripts with introns longer than this, and will ignore SAM alignments with REF_SKIP CIGAR operations longer than this. The default is 300,000.
169  -F        After calculating isoform abundance for a gene, Cufflinks filters out transcripts that it believes are very low abundance, because isoforms expressed at extremely low levels often cannot reliably be assembled, and may even be artifacts of incompletely spliced precursors of processed transcripts. This parameter is also used to filter out introns that have far fewer spliced alignments supporting them. The default is 0.05, or 5% of the most abundant isoform (the major isoform) of the gene.
170  -j        Some RNA-Seq protocols produce a significant amount of reads that originate from incompletely spliced transcripts, and these reads can confound the assembly of fully spliced mRNAs. Cufflinks uses this parameter to filter out alignments that lie within the intronic intervals implied by the spliced alignments. The minimum depth of coverage in the intronic region covered by the alignment is divided by the number of spliced reads, and if the result is lower than this parameter value, the intronic alignments are ignored. The default is 5%.
171  -Q        Instructs Cufflinks to ignore alignments with a SAM mapping quality lower than this number. The default is 0.
172  -G        Tells Cufflinks to use the supplied reference annotation to estimate isoform expression. It will not assemble novel transcripts, and the program will ignore alignments not structurally compatible with any reference transcript. 
173    </help>
174</tool>
Note: リポジトリブラウザについてのヘルプは TracBrowser を参照してください。