| 1 | <tool id="qualityFilter" name="Filter nucleotides" version="1.0.1"> |
|---|
| 2 | <description> based on quality scores</description> |
|---|
| 3 | <command interpreter="python"> |
|---|
| 4 | quality_filter.py |
|---|
| 5 | $input |
|---|
| 6 | $out_file1 |
|---|
| 7 | $primary_species |
|---|
| 8 | $mask_species |
|---|
| 9 | $score |
|---|
| 10 | $mask_char |
|---|
| 11 | ${mask_region.region} |
|---|
| 12 | #if $mask_region.region == "3" |
|---|
| 13 | ${mask_region.lengthr},${mask_region.lengthl} |
|---|
| 14 | #elif $mask_region.region == "0" |
|---|
| 15 | 1 |
|---|
| 16 | #else |
|---|
| 17 | ${mask_region.length} |
|---|
| 18 | #end if |
|---|
| 19 | ${GALAXY_DATA_INDEX_DIR}/quality_scores.loc |
|---|
| 20 | </command> |
|---|
| 21 | <inputs> |
|---|
| 22 | <param format="maf" name="input" type="data" label="Select data"/> |
|---|
| 23 | <param name="primary_species" type="select" label="Use quality scores of" display="checkboxes" multiple="true"> |
|---|
| 24 | <options> |
|---|
| 25 | <filter type="data_meta" ref="input" key="species" /> |
|---|
| 26 | </options> |
|---|
| 27 | </param> |
|---|
| 28 | <param name="mask_species" type="select" label="Mask Species" display="checkboxes" multiple="true"> |
|---|
| 29 | <options> |
|---|
| 30 | <filter type="data_meta" ref="input" key="species" /> |
|---|
| 31 | </options> |
|---|
| 32 | </param> |
|---|
| 33 | <param name="score" size="10" type="integer" value="20" label="Quality score cut-off" help="Cut-off value of 20 means mask all nucleotides having quality score less than or equal to 20"/> |
|---|
| 34 | <param name="mask_char" size="5" type="select" label="Mask character"> |
|---|
| 35 | <option value="0" selected="true">#</option> |
|---|
| 36 | <option value="1">$</option> |
|---|
| 37 | <option value="2">^</option> |
|---|
| 38 | <option value="3">*</option> |
|---|
| 39 | <option value="4">?</option> |
|---|
| 40 | <option value="5">N</option> |
|---|
| 41 | </param> |
|---|
| 42 | <conditional name="mask_region"> |
|---|
| 43 | <param name="region" type="select" label="Mask region"> |
|---|
| 44 | <option value="0" selected="true">Only the corresponding nucleotide </option> |
|---|
| 45 | <option value="1">Corresponding column + right-side neighbors</option> |
|---|
| 46 | <option value="2">Corresponding column + left-side neighbors</option> |
|---|
| 47 | <option value="3">Corresponding column + neighbors on both sides</option> |
|---|
| 48 | </param> |
|---|
| 49 | <when value="0"> |
|---|
| 50 | </when> |
|---|
| 51 | <when value="1"> |
|---|
| 52 | <param name="length" size="10" type="integer" value="2" label="Number of right-side neighbors"/> |
|---|
| 53 | </when> |
|---|
| 54 | <when value="2"> |
|---|
| 55 | <param name="length" size="10" type="integer" value="2" label="Number of left-side neighbors"/> |
|---|
| 56 | </when> |
|---|
| 57 | <when value="3"> |
|---|
| 58 | <param name="lengthr" size="10" type="integer" value="2" label="Number of neighbors on right-side" /> |
|---|
| 59 | <param name="lengthl" size="10" type="integer" value="2" label="Number of neighbors on left-side" /> |
|---|
| 60 | </when> |
|---|
| 61 | </conditional> |
|---|
| 62 | </inputs> |
|---|
| 63 | <outputs> |
|---|
| 64 | <data format="maf" name="out_file1" metadata_source="input"/> |
|---|
| 65 | </outputs> |
|---|
| 66 | <requirements> |
|---|
| 67 | <requirement type="python-module">numpy</requirement> |
|---|
| 68 | </requirements> |
|---|
| 69 | <tests> |
|---|
| 70 | <test> |
|---|
| 71 | <param name="input" value="6.maf"/> |
|---|
| 72 | <param name="primary_species" value="panTro2"/> |
|---|
| 73 | <param name="mask_species" value="hg18"/> |
|---|
| 74 | <param name="score" value="50"/> |
|---|
| 75 | <param name="mask_char" value="0"/> |
|---|
| 76 | <param name="region" value="0" /> |
|---|
| 77 | <param name="length" value="1" /> |
|---|
| 78 | <output name="out_file1" file="6_quality_filter.maf"/> |
|---|
| 79 | </test> |
|---|
| 80 | </tests> |
|---|
| 81 | <help> |
|---|
| 82 | |
|---|
| 83 | .. class:: infomark |
|---|
| 84 | |
|---|
| 85 | **What it does** |
|---|
| 86 | |
|---|
| 87 | This tool takes a MAF file as input and filters nucleotides in every alignment block of the MAF file based on their quality/PHRED scores. |
|---|
| 88 | |
|---|
| 89 | ----- |
|---|
| 90 | |
|---|
| 91 | .. class:: warningmark |
|---|
| 92 | |
|---|
| 93 | **Note** |
|---|
| 94 | |
|---|
| 95 | Any block/s not containing the primary species (species whose quality scores is to be used), will be omitted. |
|---|
| 96 | Also, any primary species whose quality scores are not available in Galaxy will be considered as a non-primary species. This info will appear as a message in the job history panel. |
|---|
| 97 | |
|---|
| 98 | ----- |
|---|
| 99 | |
|---|
| 100 | **Example** |
|---|
| 101 | |
|---|
| 102 | - For the following alignment block:: |
|---|
| 103 | |
|---|
| 104 | a score=4050.0 |
|---|
| 105 | s hg18.chrX 3719221 48 - 154913754 tattttacatttaaaataaatatgtaaatatatattttatatttaaaa |
|---|
| 106 | s panTro2.chrX 3560945 48 - 155361357 tattttatatttaaaataaagatgtaaatatatattttatatttaaaa |
|---|
| 107 | |
|---|
| 108 | - running this tool with **Primary species as panTro2**, **Mask species as hg18, panTro2**, **Quality cutoff as 20**, **Mask character as #** and **Mask region as only the corresponding position** will return:: |
|---|
| 109 | |
|---|
| 110 | a score=4050.0 |
|---|
| 111 | s hg18.chrX 3719221 48 - 154913754 ###tttac#####a###a#atatgtaaat###tattt#####ttaaaa |
|---|
| 112 | s panTro2.chrX 3560945 48 - 155361357 ###tttat#####a###a#agatgtaaat###tattt#####ttaaaa |
|---|
| 113 | |
|---|
| 114 | where, the positions containing # represent panTro2 nucleotides having quality scores less than 20. |
|---|
| 115 | </help> |
|---|
| 116 | </tool> |
|---|