| 1 | #!/usr/bin/env python |
|---|
| 2 | |
|---|
| 3 | """ |
|---|
| 4 | Runs Lastz paired read alignment process |
|---|
| 5 | Written for Lastz v. 1.02.00. |
|---|
| 6 | |
|---|
| 7 | # Author(s): based on various scripts written by Bob Harris (rsharris@bx.psu.edu), |
|---|
| 8 | # then tweaked to this form by Greg Von Kuster (greg@bx.psu.edu) |
|---|
| 9 | |
|---|
| 10 | This tool takes the following input: |
|---|
| 11 | a. A collection of 454 paired end reads ( a fasta file ) |
|---|
| 12 | b. A linker sequence ( a very small fasta file ) |
|---|
| 13 | c. A reference genome ( nob, 2bit or fasta ) |
|---|
| 14 | |
|---|
| 15 | and uses the following process: |
|---|
| 16 | 1. Split reads into mates: the input to this step is the read file XXX.fasta, and the output is three |
|---|
| 17 | files; XXX.short.fasta, XXX.long.fasta and XXX.mapping. The mapping file records the information necessary |
|---|
| 18 | to convert mate coordinates back into the original read, which is needed later in the process. |
|---|
| 19 | |
|---|
| 20 | 2. Align short mates to the reference: this runs lastz against every chromosome. The input is XXX.short.fasta |
|---|
| 21 | and the reference genome, and the output is a SAM file, XXX.short.sam. |
|---|
| 22 | |
|---|
| 23 | 3. Align long mates to the reference: this runs lastz against every chromosome. The input is XXX.long.fasta |
|---|
| 24 | and the reference genome, and the output is a SAM file, XXX.long.sam. |
|---|
| 25 | |
|---|
| 26 | 4. Combine, and convert mate coordinates back to read coordinates. The input is XXX.mapping, XXX.short.sam and |
|---|
| 27 | XXX.long.sam, and the output is XXX.sam. |
|---|
| 28 | |
|---|
| 29 | usage: lastz_paired_reads_wrapper.py [options] |
|---|
| 30 | --ref_name: The reference name to change all output matches to |
|---|
| 31 | --ref_source: The reference is cached or from the history |
|---|
| 32 | --source_select: Use pre-set or cached reference file |
|---|
| 33 | --input1: The name of the reference file if using history or reference base name if using cached |
|---|
| 34 | --input2: The reads file to align |
|---|
| 35 | --input3: The sequencing linker file |
|---|
| 36 | --input4: The base quality score 454 file |
|---|
| 37 | --ref_sequences: The number of sequences in the reference file if using one from history |
|---|
| 38 | --output: The name of the output file |
|---|
| 39 | --lastz_seqs_file_dir: Directory of local lastz_seqs.loc file |
|---|
| 40 | """ |
|---|
| 41 | import optparse, os, subprocess, shutil, sys, tempfile, time |
|---|
| 42 | from string import maketrans |
|---|
| 43 | |
|---|
| 44 | from galaxy import eggs |
|---|
| 45 | import pkg_resources |
|---|
| 46 | pkg_resources.require( 'bx-python' ) |
|---|
| 47 | from bx.seq.twobit import * |
|---|
| 48 | from bx.seq.fasta import FastaReader |
|---|
| 49 | from galaxy.util.bunch import Bunch |
|---|
| 50 | from galaxy.util import string_as_bool |
|---|
| 51 | |
|---|
| 52 | # Column indexes for SAM required fields |
|---|
| 53 | SAM_QNAME_COLUMN = 0 |
|---|
| 54 | SAM_FLAG_COLUMN = 1 |
|---|
| 55 | SAM_RNAME_COLUMN = 2 |
|---|
| 56 | SAM_POS_COLUMN = 3 |
|---|
| 57 | SAM_MAPQ_COLUMN = 4 |
|---|
| 58 | SAM_CIGAR_COLUMN = 5 |
|---|
| 59 | SAM_MRNM_COLUMN = 6 |
|---|
| 60 | SAM_MPOS_COLUMN = 7 |
|---|
| 61 | SAM_ISIZE_COLUMN = 8 |
|---|
| 62 | SAM_SEQ_COLUMN = 9 |
|---|
| 63 | SAM_QUAL_COLUMN = 10 |
|---|
| 64 | SAM_MIN_COLUMNS = 11 |
|---|
| 65 | # SAM bit-encoded flags |
|---|
| 66 | BAM_FPAIRED = 1 # the read is paired in sequencing, no matter whether it is mapped in a pair |
|---|
| 67 | BAM_FPROPER_PAIR = 2 # the read is mapped in a proper pair |
|---|
| 68 | BAM_FUNMAP = 4 # the read itself is unmapped; conflictive with BAM_FPROPER_PAIR |
|---|
| 69 | BAM_FMUNMAP = 8 # the mate is unmapped |
|---|
| 70 | BAM_FREVERSE = 16 # the read is mapped to the reverse strand |
|---|
| 71 | BAM_FMREVERSE = 32 # the mate is mapped to the reverse strand |
|---|
| 72 | BAM_FREAD1 = 64 # this is read1 |
|---|
| 73 | BAM_FREAD2 = 128 # this is read2 |
|---|
| 74 | BAM_FSECONDARY = 256 # not primary alignment |
|---|
| 75 | BAM_FQCFAIL = 512 # QC failure |
|---|
| 76 | BAM_FDUP = 1024 # optical or PCR duplicate |
|---|
| 77 | |
|---|
| 78 | # Keep track of all created temporary files so they can be deleted |
|---|
| 79 | global tmp_file_names |
|---|
| 80 | tmp_file_names = [] |
|---|
| 81 | # The values in the skipped_lines dict are tuples consisting of: |
|---|
| 82 | # - the number of skipped lines for that error |
|---|
| 83 | # If not a sequence error: |
|---|
| 84 | # - the 1st line number on which the error was found |
|---|
| 85 | # - the text of the 1st line on which the error was found |
|---|
| 86 | # If a sequence error: |
|---|
| 87 | # - The number of the sequence in the file |
|---|
| 88 | # - the sequence name on which the error occurred |
|---|
| 89 | # We may need to improve dealing with file position and text as |
|---|
| 90 | # much of it comes from temporary files that are created from the |
|---|
| 91 | # inputs, and not the inputs themselves, so this could be confusing |
|---|
| 92 | # to the user. |
|---|
| 93 | global skipped_lines |
|---|
| 94 | skipped_lines = dict( bad_interval=( 0, 0, '' ), |
|---|
| 95 | inconsistent_read_lengths=( 0, 0, '' ), |
|---|
| 96 | inconsistent_reads=( 0, 0, '' ), |
|---|
| 97 | inconsistent_sizes=( 0, 0, '' ), |
|---|
| 98 | missing_mate=( 0, 0, '' ), |
|---|
| 99 | missing_quals=( 0, 0, '' ), |
|---|
| 100 | missing_seq=( 0, 0, '' ), |
|---|
| 101 | multiple_seqs=( 0, 0, '' ), |
|---|
| 102 | no_header=( 0, 0, '' ), |
|---|
| 103 | num_fields=( 0, 0, '' ), |
|---|
| 104 | reads_paired=( 0, 0, '' ), |
|---|
| 105 | sam_flag=( 0, 0, '' ), |
|---|
| 106 | sam_headers=( 0, 0, '' ), |
|---|
| 107 | sam_min_columns=( 0, 0, '' ), |
|---|
| 108 | two_mate_names=( 0, 0, '' ), |
|---|
| 109 | wrong_seq_len=( 0, 0, '' ) ) |
|---|
| 110 | global total_skipped_lines |
|---|
| 111 | total_skipped_lines = 0 |
|---|
| 112 | |
|---|
| 113 | def stop_err( msg ): |
|---|
| 114 | sys.stderr.write( "%s" % msg ) |
|---|
| 115 | sys.exit() |
|---|
| 116 | |
|---|
| 117 | def skip_line( error_key, position, text ): |
|---|
| 118 | if not skipped_lines[ error_key ][2]: |
|---|
| 119 | skipped_lines[ error_key ][1] = position |
|---|
| 120 | skipped_lines[ error_key ][2] = text |
|---|
| 121 | skipped_lines[ error_key ][0] += 1 |
|---|
| 122 | total_skipped_lines += 1 |
|---|
| 123 | |
|---|
| 124 | def get_tmp_file_name( dir=None, suffix=None ): |
|---|
| 125 | """ |
|---|
| 126 | Return a unique temporary file name that can be managed. The |
|---|
| 127 | file must be manually removed after use. |
|---|
| 128 | """ |
|---|
| 129 | if dir and suffix: |
|---|
| 130 | tmp_fd, tmp_name = tempfile.mkstemp( dir=dir, suffix=suffix ) |
|---|
| 131 | elif dir: |
|---|
| 132 | tmp_fd, tmp_name = tempfile.mkstemp( dir=dir ) |
|---|
| 133 | elif suffix: |
|---|
| 134 | tmp_fd, tmp_name = tempfile.mkstemp( suffix=suffix ) |
|---|
| 135 | os.close( tmp_fd ) |
|---|
| 136 | tmp_file_names.append( tmp_name ) |
|---|
| 137 | return tmp_name |
|---|
| 138 | |
|---|
| 139 | def run_command( command ): |
|---|
| 140 | proc = subprocess.Popen( args=command, shell=True, stderr=subprocess.PIPE, ) |
|---|
| 141 | proc.wait() |
|---|
| 142 | stderr = proc.stderr.read() |
|---|
| 143 | proc.wait() |
|---|
| 144 | if stderr: |
|---|
| 145 | stop_err( stderr ) |
|---|
| 146 | |
|---|
| 147 | def split_paired_reads( input2, combined_linker_file_name ): |
|---|
| 148 | """ |
|---|
| 149 | Given a fasta file of allegedly paired end reads ( input2 ), and a list of intervals |
|---|
| 150 | showing where the linker is on each read ( combined_linker_file_name ), split the reads into left and right |
|---|
| 151 | halves. |
|---|
| 152 | |
|---|
| 153 | The input intervals look like this. Note that they may include multiple intervals for the same read |
|---|
| 154 | ( which should overlap ), and we use the union of them as the linker interval. Non-overlaps are |
|---|
| 155 | reported to the user, and those reads are not processed. Starts are origin zero. |
|---|
| 156 | |
|---|
| 157 | #name strand start len size |
|---|
| 158 | FG3OYDA05FTEES + 219 42 283 |
|---|
| 159 | FG3OYDA05FVOLL + 263 41 416 |
|---|
| 160 | FG3OYDA05FFL7J + 81 42 421 |
|---|
| 161 | FG3OYDA05FOQWE + 55 42 332 |
|---|
| 162 | FG3OYDA05FV4DW + 297 42 388 |
|---|
| 163 | FG3OYDA05FWAQV + 325 42 419 |
|---|
| 164 | FG3OYDA05FVLGA + 90 42 367 |
|---|
| 165 | FG3OYDA05FWJ71 + 58 42 276 |
|---|
| 166 | |
|---|
| 167 | The output gives each half-sequence on a separate line, like this. This allows easy sorting of the |
|---|
| 168 | sequences by length, after the fact. |
|---|
| 169 | |
|---|
| 170 | 219 FG3OYDA05FTEES_L TTTAGTTACACTTAACTCACTTCCATCCTCTAAATACGTGATTACCTTTC... |
|---|
| 171 | 22 FG3OYDA05FTEES_R CCTTCCTTAAGTCCTAAAACTG |
|---|
| 172 | """ |
|---|
| 173 | # Bob says these should be hard-coded. |
|---|
| 174 | seq_len_lower_threshold = 17 |
|---|
| 175 | short_mate_cutoff = 50 |
|---|
| 176 | # We need to pass the name of this file back to the caller. |
|---|
| 177 | tmp_mates_file_name = get_tmp_file_name( suffix='mates.txt' ) |
|---|
| 178 | mates_file = file( tmp_mates_file_name, "w+b" ) |
|---|
| 179 | # Read the linker intervals |
|---|
| 180 | combined_linker_file = file( combined_linker_file_name, "rb" ) |
|---|
| 181 | read_to_linker_dict = {} |
|---|
| 182 | i = 0 |
|---|
| 183 | for i, line in enumerate( combined_linker_file ): |
|---|
| 184 | line = line.strip() |
|---|
| 185 | if line.startswith( "#" ): |
|---|
| 186 | continue |
|---|
| 187 | if line.find( '#' ) >= 0: |
|---|
| 188 | line = line.split( "#", 1 )[0].rstrip() |
|---|
| 189 | fields = line.split() |
|---|
| 190 | if len( fields ) != 4: |
|---|
| 191 | skip_line( 'num_fields', i+1, line ) |
|---|
| 192 | continue |
|---|
| 193 | name, start, length, size = fields |
|---|
| 194 | start = int( start ) |
|---|
| 195 | length = int( length ) |
|---|
| 196 | size = int( size ) |
|---|
| 197 | end = start + length |
|---|
| 198 | if end > size: |
|---|
| 199 | skip_line[ 'bad_interval' ] += 1 |
|---|
| 200 | continue |
|---|
| 201 | if name not in read_to_linker_dict: |
|---|
| 202 | read_to_linker_dict[ name ] = ( start, end, size ) |
|---|
| 203 | continue |
|---|
| 204 | if read_to_linker_dict[ name ] == None: |
|---|
| 205 | # Read previously marked as non-overlapping intervals, so skip this sequence - see below |
|---|
| 206 | continue |
|---|
| 207 | ( s, e, sz ) = read_to_linker_dict[ name ] |
|---|
| 208 | if sz != size: |
|---|
| 209 | skip_line( 'inconsistent_sizes', i+1, name ) |
|---|
| 210 | continue |
|---|
| 211 | if s > end or e < start: |
|---|
| 212 | # Non-overlapping intervals, so skip this sequence |
|---|
| 213 | read_to_linker_dict[ name ] = None |
|---|
| 214 | continue |
|---|
| 215 | read_to_linker_dict[ name ] = ( min( s, start ), max( e, end ), size ) |
|---|
| 216 | combined_linker_file.close() |
|---|
| 217 | # We need to pass the name of this file back to the caller. |
|---|
| 218 | tmp_mates_mapping_file_name = get_tmp_file_name( suffix='mates.mapping' ) |
|---|
| 219 | mates_mapping_file = file( tmp_mates_mapping_file_name, 'w+b' ) |
|---|
| 220 | # Process the sequences |
|---|
| 221 | seqs = 0 |
|---|
| 222 | fasta_reader = FastaReader( file( input2, 'rb' ) ) |
|---|
| 223 | while True: |
|---|
| 224 | seq = fasta_reader.next() |
|---|
| 225 | if not seq: |
|---|
| 226 | break |
|---|
| 227 | seqs += 1 |
|---|
| 228 | if seq.name not in read_to_linker_dict: |
|---|
| 229 | if seq.length > seq_len_lower_threshold: |
|---|
| 230 | mates_file.write( "%-3d %s %s\n" % ( seq.length, seq.name, seq.text ) ) |
|---|
| 231 | read_to_linker_dict[ seq.name ] = "" |
|---|
| 232 | continue |
|---|
| 233 | if read_to_linker_dict[ seq.name ] == "": |
|---|
| 234 | skip_line( 'multiple_seqs', seqs, seq.name ) |
|---|
| 235 | continue |
|---|
| 236 | if read_to_linker_dict[ seq.name ] == None: |
|---|
| 237 | # Read previously marked as non-overlapping intervals, so skip this sequence - see above |
|---|
| 238 | continue |
|---|
| 239 | ( start, end, size ) = read_to_linker_dict[ seq.name ] |
|---|
| 240 | if seq.length != size: |
|---|
| 241 | skip_line( 'wrong_seq_len', seqs, seq.name ) |
|---|
| 242 | continue |
|---|
| 243 | left = seq.text[ :start ] |
|---|
| 244 | right = seq.text[ end: ] |
|---|
| 245 | left_is_small = len( left ) <= seq_len_lower_threshold |
|---|
| 246 | right_is_small = len( right ) <= seq_len_lower_threshold |
|---|
| 247 | if left_is_small and right_is_small: |
|---|
| 248 | continue |
|---|
| 249 | if not left_is_small: |
|---|
| 250 | mates_file.write( "%-3d %s %s\n" % ( len( left ), seq.name + "_L", left ) ) |
|---|
| 251 | mates_mapping_file.write( "%s %s %s %s\n" % ( seq.name + "_L", seq.name, 0, size - start ) ) |
|---|
| 252 | if not right_is_small: |
|---|
| 253 | mates_file.write( "%-3d %s %s\n" % ( len( right ), seq.name + "_R", right ) ) |
|---|
| 254 | mates_mapping_file.write( "%s %s %s %s\n" % ( seq.name + "_R", seq.name, end, 0 ) ) |
|---|
| 255 | read_to_linker_dict[ seq.name ] = "" |
|---|
| 256 | combined_linker_file.close() |
|---|
| 257 | mates_file.close() |
|---|
| 258 | mates_mapping_file.close() |
|---|
| 259 | # Create temporary files for short and long mates |
|---|
| 260 | tmp_mates_short_file_name = get_tmp_file_name( suffix='mates.short' ) |
|---|
| 261 | tmp_mates_long_file_name = get_tmp_file_name( suffix='mates.long' ) |
|---|
| 262 | tmp_mates_short = open( tmp_mates_short_file_name, 'w+b' ) |
|---|
| 263 | tmp_mates_long = open( tmp_mates_long_file_name, 'w+b' ) |
|---|
| 264 | i = 0 |
|---|
| 265 | for i, line in enumerate( file( tmp_mates_file_name, 'rb' ) ): |
|---|
| 266 | fields = line.split() |
|---|
| 267 | seq_len = int( fields[0] ) |
|---|
| 268 | seq_name = fields[1] |
|---|
| 269 | seq_text = fields[2] |
|---|
| 270 | if seq_len <= short_mate_cutoff: |
|---|
| 271 | tmp_mates_short.write( ">%s\n%s\n" % ( seq_name, seq_text ) ) |
|---|
| 272 | else: |
|---|
| 273 | tmp_mates_long.write( ">%s\n%s\n" % ( seq_name, seq_text ) ) |
|---|
| 274 | tmp_mates_short.close() |
|---|
| 275 | tmp_mates_long.close() |
|---|
| 276 | return tmp_mates_mapping_file_name, tmp_mates_file_name, tmp_mates_short_file_name, tmp_mates_long_file_name |
|---|
| 277 | |
|---|
| 278 | def align_mates( input1, ref_source, ref_name, ref_sequences, tmp_mates_short_file_name, tmp_mates_long_file_name ): |
|---|
| 279 | tmp_align_file_names = [] |
|---|
| 280 | if ref_source == 'history': |
|---|
| 281 | # Reference is a fasta dataset from the history |
|---|
| 282 | # Create temporary files to contain the output from lastz executions |
|---|
| 283 | tmp_short_file_name = get_tmp_file_name( suffix='short_out' ) |
|---|
| 284 | tmp_align_file_names.append( tmp_short_file_name ) |
|---|
| 285 | tmp_long_file_name = get_tmp_file_name( suffix='long_out' ) |
|---|
| 286 | tmp_align_file_names.append( tmp_long_file_name ) |
|---|
| 287 | seqs = 0 |
|---|
| 288 | fasta_reader = FastaReader( open( input1 ) ) |
|---|
| 289 | while True: |
|---|
| 290 | # Read the next sequence from the reference dataset. Note that if the reference contains |
|---|
| 291 | # a small number of chromosomes this loop is ok, but in many cases the genome has a bunch |
|---|
| 292 | # of small straggler scaffolds and contigs and it is a computational waste to do each one |
|---|
| 293 | # of these in its own run. There is an I/O down side to running by subsets (even if they are |
|---|
| 294 | # one sequence per subset), compared to splitting the reference into sizes of 250 mb. With |
|---|
| 295 | # the subset action, lastz still has to read and parse the entire file for every run (this |
|---|
| 296 | # is true for fasta, but for .2bit files it can access each sequence directly within the file, |
|---|
| 297 | # so the overhead is minimal). |
|---|
| 298 | """ |
|---|
| 299 | :> output_file (this creates the output file, empty) |
|---|
| 300 | while there are more sequences to align |
|---|
| 301 | find the next sequences that add up to 250M, put their names in farf.names |
|---|
| 302 | lastz ${refFile}[subset=farf.names][multi][unmask] ${matesPath}/${matesFile} ... |
|---|
| 303 | >> output_file |
|---|
| 304 | """ |
|---|
| 305 | seq = fasta_reader.next() |
|---|
| 306 | if not seq: |
|---|
| 307 | break |
|---|
| 308 | seqs += 1 |
|---|
| 309 | # Create a temporary file to contain the current sequence as input to lastz. |
|---|
| 310 | # We're doing this a bit differently here since we could be generating a huge |
|---|
| 311 | # number of temporary files. |
|---|
| 312 | tmp_in_fd, tmp_in_file_name = tempfile.mkstemp( suffix='seq_%d_in' % seqs ) |
|---|
| 313 | tmp_in_file = os.fdopen( tmp_in_fd, 'w+b' ) |
|---|
| 314 | tmp_in_file.write( '>%s\n%s\n' % ( seq.name, seq.text ) ) |
|---|
| 315 | tmp_in_file.close() |
|---|
| 316 | # Align short mates |
|---|
| 317 | command = 'lastz %s[unmask]%s %s ' % ( tmp_in_file_name, ref_name, tmp_mates_short_file_name ) |
|---|
| 318 | command += 'Z=1 --seed=1111111011111 --notrans --maxwordcount=90% --match=1,3 O=1 E=3 X=15 K=10 Y=12 L=18 --ambiguousn --noytrim --identity=95 --coverage=80 --continuity=95 --format=softsam- ' |
|---|
| 319 | command += '>> %s' % tmp_short_file_name |
|---|
| 320 | run_command( command ) |
|---|
| 321 | # Align long mates |
|---|
| 322 | command = 'lastz %s[unmask]%s %s ' % ( tmp_in_file_name, ref_name, tmp_mates_long_file_name ) |
|---|
| 323 | command += 'Z=15 W=13 --notrans --exact=18 --maxwordcount=90% --match=1,3 O=1 E=3 Y=10 L=18 --ambiguousn --noytrim --identity=95 --coverage=90 --continuity=95 --format=softsam- ' |
|---|
| 324 | command += '>> %s' % tmp_long_file_name |
|---|
| 325 | run_command( command ) |
|---|
| 326 | # Remove the temporary file that contains the current sequence |
|---|
| 327 | os.remove( tmp_in_file_name ) |
|---|
| 328 | else: |
|---|
| 329 | # Reference is a locally cached 2bit file, split lastz calls across number of chroms in 2bit file |
|---|
| 330 | tbf = TwoBitFile( open( input1, 'rb' ) ) |
|---|
| 331 | for chrom in tbf.keys(): |
|---|
| 332 | # Align short mates |
|---|
| 333 | tmp_short_file_name = get_tmp_file_name( suffix='short_vs_%s' % chrom ) |
|---|
| 334 | tmp_align_file_names.append( tmp_short_file_name ) |
|---|
| 335 | command = 'lastz %s/%s[unmask]%s %s ' % ( input1, chrom, ref_name, tmp_mates_short_file_name ) |
|---|
| 336 | command += 'Z=1 --seed=1111111011111 --notrans --maxwordcount=90% --match=1,3 O=1 E=3 X=15 K=10 Y=12 L=18 --ambiguousn --noytrim --identity=95 --coverage=80 --continuity=95 --format=softsam- ' |
|---|
| 337 | command += '> %s' % tmp_short_file_name |
|---|
| 338 | run_command( command ) |
|---|
| 339 | # Align long mates |
|---|
| 340 | tmp_long_file_name = get_tmp_file_name( suffix='long_vs_%s' % chrom ) |
|---|
| 341 | tmp_align_file_names.append( tmp_long_file_name ) |
|---|
| 342 | command = 'lastz %s/%s[unmask]%s %s ' % ( input1, chrom, ref_name, tmp_mates_long_file_name ) |
|---|
| 343 | command += 'Z=15 W=13 --notrans --exact=18 --maxwordcount=90% --match=1,3 O=1 E=3 Y=10 L=18 --ambiguousn --noytrim --identity=95 --coverage=90 --continuity=95 --format=softsam- ' |
|---|
| 344 | command += '> %s' % tmp_long_file_name |
|---|
| 345 | run_command( command ) |
|---|
| 346 | return tmp_align_file_names |
|---|
| 347 | |
|---|
| 348 | def paired_mate_unmapper( input2, input4, tmp_mates_mapping_file_name, tmp_align_file_name_list, output ): |
|---|
| 349 | """ |
|---|
| 350 | Given a SAM file corresponding to alignments of *subsegments* of paired 'reads' to a reference sequence, |
|---|
| 351 | convert the positions on the subsegments to positions on the reads. Also (optionally) add quality values. |
|---|
| 352 | |
|---|
| 353 | The input file is in SAM format, as shown below. Each line represents the alignment of a part of a read |
|---|
| 354 | to a reference sequence. Read pairs are indicated by suffixes in their names. Normally, the suffixes _L |
|---|
| 355 | and _R indicate the left and right mates of reads (this can be overridden with the --left and --right |
|---|
| 356 | options). Reads that were not mates have no suffix. |
|---|
| 357 | |
|---|
| 358 | (SAM header lines omitted) |
|---|
| 359 | F2YP0BU02G7LK5_R 16 chr21 15557360 255 40M * 0 0 ATTTTATTCTCTTTGAAGCAATTGTGAATGGGAGTTTACT * |
|---|
| 360 | F2YP0BU02HXV58_L 16 chr21 15952091 255 40M6S * 0 0 GCAAATTGTGCTGCTTTAAACATGCGTGTGCAAGTATCTTtttcat * |
|---|
| 361 | F2YP0BU02HREML_R 0 chr21 16386077 255 33M5S * 0 0 CCAAAGTTCTGGGATTACAGGCGTGAGCCATCGcgccc * |
|---|
| 362 | F2YP0BU02IOF1F_L 0 chr21 17567321 255 7S28M * 0 0 taaagagAAGAATTCTCAACCCAGAATTTCATATC * |
|---|
| 363 | F2YP0BU02IKX84_R 16 chr21 18491628 255 22M1D18M9S * 0 0 GTCTCTACCAAAAAATACAAAAATTAGCCGGGCGTGGTGGcatgtctgt * |
|---|
| 364 | F2YP0BU02GW5VA_L 16 chr21 20255344 255 6S32M * 0 0 caagaaCAAACACATTCAAAAGCTAGTAGAAGGCAAGA * |
|---|
| 365 | F2YP0BU02JIMJ4_R 0 chr21 22383051 255 19M * 0 0 CCCTTTATCATTTTTTATT * |
|---|
| 366 | F2YP0BU02IXZGF_L 16 chr21 23094798 255 13M1I18M * 0 0 GCAAGCTCCACTTCCCGGGTTCACGCCATTCT * |
|---|
| 367 | F2YP0BU02IODR5_L 0 chr21 30935325 255 37M * 0 0 GAAATAAAGGGTATTCAATTAGGAAAAGAGGAAGTCA * |
|---|
| 368 | F2YP0BU02IMZBL_L 16 chr21 31603486 255 28M1D1M * 0 0 ATACAAAAATTAGCCGGGCACAGTGGCAG * |
|---|
| 369 | F2YP0BU02JA9PR_L 16 chr21 31677159 255 23M * 0 0 CACACCTGTAACCCCAGCACTTT * |
|---|
| 370 | F2YP0BU02HKC61_R 0 chr21 31678718 255 40M * 0 0 CACTGCACTCCAGCCTGGGTGACAAAGCAAGACTCTGTCT * |
|---|
| 371 | F2YP0BU02HKC61_R 0 chr21 31678718 255 40M * 0 0 CACTGCACTCCAGCCTGGGTGACAAAGCAAGACTCTGTCT * |
|---|
| 372 | F2YP0BU02HVA88 16 chr21 31703558 255 1M1D35M8S * 0 0 TGGGATTACAGGCGTGAGCTACCACACCCAGCCAGAgttcaaat * |
|---|
| 373 | F2YP0BU02JDCF1_L 0 chr21 31816600 255 38M * 0 0 AGGAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCGGT * |
|---|
| 374 | F2YP0BU02GZ1GO_R 0 chr21 33360122 255 6S38M * 0 0 cctagaCTTCACACACACACACACACACACACACACACACACAC * |
|---|
| 375 | F2YP0BU02FX387_L 16 chr22 14786201 255 26M * 0 0 TGGATGAAGCTGGAAACCATCATTCT * |
|---|
| 376 | F2YP0BU02IF2NE_R 0 chr22 16960842 255 40M10S * 0 0 TGGCATGCACCTGTAGTCTCAGCTACTTGGGAGGCTGAGGtgggaggatc * |
|---|
| 377 | F2YP0BU02F4TVA 0 chr22 19200522 255 49M * 0 0 CCTGGGAGGCGGAGGTTGCAGTGAGCCGAGATCACGCCATTGCACTCCA * |
|---|
| 378 | F2YP0BU02HKC61_R 16 chr22 29516998 255 8S32M * 0 0 agacagagTCTTGCTTTGTCACCCAGGCTGGAGTGCAGTG * |
|---|
| 379 | F2YP0BU02FS4EM_R 0 chr22 30159364 255 29M * 0 0 CTCCTGCCTCAGCCTCCCGAGTAGTTGGG * |
|---|
| 380 | F2YP0BU02G197P_L 0 chr22 32044496 255 40M10S * 0 0 TTGTTGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTgaataatgcc * |
|---|
| 381 | F2YP0BU02FIING 16 chr22 45959944 255 3M1I11M1I26M * 0 0 AGCTATGGTACTGGCTATGAAAGCAGACACATAGACCAATGG * |
|---|
| 382 | F2YP0BU02GUB9L_L 16 chr22 49198404 255 16M1I20M * 0 0 CACCACGCTCGGCTAATTTTTGTATTTTTAGTAGAGA * |
|---|
| 383 | |
|---|
| 384 | The user must provide a mapping file (which might better be called an unmapping file). This file is usually |
|---|
| 385 | created by split_paired_reads, and tells us how to map the subsegments back to original coordinates in a single |
|---|
| 386 | read (this means the left and right mates were part of a single read). The mapping file contains four columns. |
|---|
| 387 | The first two give the mates's name (including the suffix) and the read name. The last two columns describe how |
|---|
| 388 | much of the full original sequence is missing from the mate. For example, in the read below, the left mate is |
|---|
| 389 | missing 63 on the right (42 for the linker and 21 for the right half). The right mate is missing 339 on the left. |
|---|
| 390 | |
|---|
| 391 | left half: TTTCAACATATGCAAATCAATAAATGTAATCCAGCATATAAACAGAACCA |
|---|
| 392 | AAGACAAAAACCACATGATTATCTCAATAGATGCAGAAAAGGCCTTCGGC |
|---|
| 393 | AAAATTCAACAAAACTCCATGCTAAAACTCTCAATAAGGTATTGATGGGA |
|---|
| 394 | CATGCCGCATAATAATAAGACATATCTATGACAAACCCACAGCCAATATC |
|---|
| 395 | ATGCTGAATGCACAAAAATTGGAAGCATTCCCTTTGAAAACTGGCACAAG |
|---|
| 396 | ACTGGGATGCCCTCTCTCACAACTCCTATTCAACATAGTGTTGGAAG |
|---|
| 397 | linker: CGTAATAACTTCGTATAGCATACATTATACGAAGTCATACGA |
|---|
| 398 | right half: CTCCTGCCTCAGCCTCCCGAG |
|---|
| 399 | |
|---|
| 400 | mate_name read_name offset_to_start offset_from_end |
|---|
| 401 | F2YP0BU02FS4EM_L F2YP0BU02FS4EM 0 71 |
|---|
| 402 | F2YP0BU02FS4EM_R F2YP0BU02FS4EM 339 0 |
|---|
| 403 | |
|---|
| 404 | The user can also specify a quality scores file, which should look something like this. Quality values are presumed |
|---|
| 405 | to be PHRED scores, written in space-delimited decimal. |
|---|
| 406 | |
|---|
| 407 | >F2YP0BU02FS4EM |
|---|
| 408 | 38 38 38 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 40 38 21 21 21 40 |
|---|
| 409 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 33 |
|---|
| 410 | 32 32 40 40 40 21 21 18 18 21 34 34 31 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 411 | 40 40 40 40 40 40 40 40 40 40 40 32 32 32 32 40 40 40 40 40 40 40 34 34 35 |
|---|
| 412 | 31 31 28 28 33 33 33 36 36 36 17 17 17 19 26 36 36 36 40 40 40 40 40 33 34 |
|---|
| 413 | 34 34 39 39 39 40 40 40 40 40 33 33 34 34 40 40 40 40 40 40 40 39 39 39 40 |
|---|
| 414 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 415 | 40 40 40 40 40 40 40 39 39 39 39 39 39 40 40 40 39 39 39 40 40 40 40 40 40 |
|---|
| 416 | 40 40 40 40 40 40 40 40 40 40 40 40 40 26 26 26 26 26 40 40 38 38 37 35 33 |
|---|
| 417 | 36 40 19 17 17 17 17 19 19 23 30 20 20 20 23 35 40 36 36 36 36 36 36 36 36 |
|---|
| 418 | 39 40 34 20 27 27 35 39 40 37 40 40 40 40 40 40 40 40 40 40 34 34 35 39 40 |
|---|
| 419 | 40 40 40 40 40 40 39 39 39 40 40 40 40 36 36 32 32 28 28 29 30 36 40 30 26 |
|---|
| 420 | 26 26 34 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 |
|---|
| 421 | 40 39 35 34 34 40 40 40 40 30 30 30 35 40 40 40 40 40 39 39 36 40 40 40 40 |
|---|
| 422 | 39 39 39 39 30 30 28 35 35 39 40 40 40 40 40 35 35 35 |
|---|
| 423 | >F2YP0BU02G197P |
|---|
| 424 | 40 40 40 40 40 40 40 40 40 40 39 39 39 39 39 39 40 40 40 40 40 40 40 40 40 |
|---|
| 425 | 40 40 40 40 26 26 26 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 426 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 427 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 428 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 34 34 34 40 40 |
|---|
| 429 | 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 |
|---|
| 430 | 40 40 40 40 40 40 40 34 34 34 34 40 40 40 40 34 34 34 34 40 40 40 40 40 40 |
|---|
| 431 | 40 40 40 40 40 39 39 39 34 34 34 34 40 40 40 40 39 39 25 25 26 39 40 40 40 |
|---|
| 432 | 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 433 | 33 33 33 33 40 35 21 21 21 30 38 40 40 40 40 40 40 40 40 35 35 30 30 30 40 |
|---|
| 434 | 40 40 39 39 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 |
|---|
| 435 | 40 40 40 40 40 40 40 40 40 40 40 40 39 39 39 40 40 40 40 40 40 40 40 40 40 |
|---|
| 436 | 40 40 40 39 39 39 40 40 |
|---|
| 437 | >F2YP0BU02FIING |
|---|
| 438 | 32 32 32 25 25 25 25 24 25 30 31 30 27 27 27 28 28 21 19 19 13 13 13 14 19 |
|---|
| 439 | 19 17 19 16 16 25 28 22 21 17 17 18 25 24 25 25 25 |
|---|
| 440 | |
|---|
| 441 | The output file is also SAM: |
|---|
| 442 | |
|---|
| 443 | (SAM header lines omitted) |
|---|
| 444 | F2YP0BU02G7LK5 81 chr21 15557360 255 40M303H * 0 0 ATTTTATTCTCTTTGAAGCAATTGTGAATGGGAGTTTACT D>>>>IIIIIIHHG???IIIIIIIIIHHHFFEIH999HII |
|---|
| 445 | F2YP0BU02HXV58 145 chr21 15952091 255 226H40M6S * 0 0 GCAAATTGTGCTGCTTTAAACATGCGTGTGCAAGTATCTTtttcat AA===DDDDAAAAD???:::ABBBBBAAA:888ECF;F>>>?8??@ |
|---|
| 446 | F2YP0BU02HREML 65 chr21 16386077 255 320H33M5S * 0 0 CCAAAGTTCTGGGATTACAGGCGTGAGCCATCGcgccc HH???HHIIIHFHIIIIIIICDDHHIIIIIIHHHHHHH |
|---|
| 447 | F2YP0BU02IOF1F 129 chr21 17567321 255 7S28M409H * 0 0 taaagagAAGAATTCTCAACCCAGAATTTCATATC 4100<<A>4113:<EFGGGFFFHHHHHHDFFFFED |
|---|
| 448 | F2YP0BU02IKX84 81 chr21 18491628 255 22M1D18M9S341H * 0 0 GTCTCTACCAAAAAATACAAAAATTAGCCGGGCGTGGTGGcatgtctgt ;;;=7@.55------?2?11112GGB=CCCCDIIIIIIIIIHHHHHHII |
|---|
| 449 | F2YP0BU02GW5VA 145 chr21 20255344 255 286H6S32M * 0 0 caagaaCAAACACATTCAAAAGCTAGTAGAAGGCAAGA IIIIIIIHHHIIIIIIICCCCIIIIIIIIIIIIIIIII |
|---|
| 450 | F2YP0BU02JIMJ4 65 chr21 22383051 255 208H19M * 0 0 CCCTTTATCATTTTTTATT 555544E?GE113344I22 |
|---|
| 451 | F2YP0BU02IXZGF 145 chr21 23094798 255 291H13M1I18M * 0 0 GCAAGCTCCACTTCCCGGGTTCACGCCATTCT IIIIIIIIIIIGG;;;GGHIIIIIGGGIIIII |
|---|
| 452 | F2YP0BU02IODR5 129 chr21 30935325 255 37M154H * 0 0 GAAATAAAGGGTATTCAATTAGGAAAAGAGGAAGTCA 6...7/--..,30;9<<>@BFFFAAAAHIIIIIH@@@ |
|---|
| 453 | F2YP0BU02IMZBL 145 chr21 31603486 255 342H28M1D1M * 0 0 ATACAAAAATTAGCCGGGCACAGTGGCAG BB1552222<<>9==8;;?AA=??A???A |
|---|
| 454 | F2YP0BU02JA9PR 145 chr21 31677159 255 229H23M * 0 0 CACACCTGTAACCCCAGCACTTT IIIIIIIIIIICCCCIIIIIHHH |
|---|
| 455 | F2YP0BU02HKC61 65 chr21 31678718 255 300H40M * 0 0 CACTGCACTCCAGCCTGGGTGACAAAGCAAGACTCTGTCT AA@BD:::==AAA@A?8888:<90004<>>?><<<<4442 |
|---|
| 456 | F2YP0BU02HKC61 65 chr21 31678718 255 300H40M * 0 0 CACTGCACTCCAGCCTGGGTGACAAAGCAAGACTCTGTCT AA@BD:::==AAA@A?8888:<90004<>>?><<<<4442 |
|---|
| 457 | F2YP0BU02HVA88 16 chr21 31703558 255 1M1D35M8S * 0 0 TGGGATTACAGGCGTGAGCTACCACACCCAGCCAGAgttcaaat >8888DFFHHGFHHHH@@?@?DDC96666HIIIFFFFFFFFFFF |
|---|
| 458 | F2YP0BU02JDCF1 129 chr21 31816600 255 38M103H * 0 0 AGGAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCGGT IIIIIIIIIIIHHHIIHHHIIIIIIIIIIIIIIIIIII |
|---|
| 459 | F2YP0BU02GZ1GO 65 chr21 33360122 255 76H6S38M * 0 0 cctagaCTTCACACACACACACACACACACACACACACACACAC BBBBD?:688CFFFFFFFFFFFFFFFFFFFFFFFFFFDDBBB51 |
|---|
| 460 | F2YP0BU02FX387 145 chr22 14786201 255 201H26M * 0 0 TGGATGAAGCTGGAAACCATCATTCT IIHHHHHHHHHHHHHFFFFFFFFFFF |
|---|
| 461 | F2YP0BU02IF2NE 65 chr22 16960842 255 209H40M10S * 0 0 TGGCATGCACCTGTAGTCTCAGCTACTTGGGAGGCTGAGGtgggaggatc BAAADDDDFDDDDDDBBA889<A?4444000@<>AA?9444;;8>77<7- |
|---|
| 462 | F2YP0BU02F4TVA 0 chr22 19200522 255 49M * 0 0 CCTGGGAGGCGGAGGTTGCAGTGAGCCGAGATCACGCCATTGCACTCCA FFF???FFFFFIIIIIIIIIIIIIIIIIIIIIIIHHIIFHFFFGDDB=5 |
|---|
| 463 | F2YP0BU02HKC61 81 chr22 29516998 255 8S32M300H * 0 0 agacagagTCTTGCTTTGTCACCCAGGCTGGAGTGCAGTG 2444<<<<>?>><40009<:8888?A@AAA==:::DB@AA |
|---|
| 464 | F2YP0BU02FS4EM 65 chr22 30159364 255 339H29M * 0 0 CTCCTGCCTCAGCCTCCCGAGTAGTTGGG IIIIHHEIIIIHHHH??=DDHIIIIIDDD |
|---|
| 465 | F2YP0BU02G197P 129 chr22 32044496 255 40M10S258H * 0 0 TTGTTGGACATTTGGGTTGGTTCCAAGTCTTTGCTATTGTgaataatgcc IIIIIIIIIIHHHHHHIIIIIIIIIIIII;;;IIIIIIIIIIIIIIIIII |
|---|
| 466 | F2YP0BU02FIING 16 chr22 45959944 255 3M1I11M1I26M * 0 0 AGCTATGGTACTGGCTATGAAAGCAGACACATAGACCAATGG :::9:32267=:114244/...446==<<<?@?:9::::AAA |
|---|
| 467 | F2YP0BU02GUB9L 145 chr22 49198404 255 176H16M1I20M * 0 0 CACCACGCTCGGCTAATTTTTGTATTTTTAGTAGAGA IIIIIIIIIHAAC;<</////@4F5778;IIIIIIII |
|---|
| 468 | |
|---|
| 469 | """ |
|---|
| 470 | left_suffix = "_L" |
|---|
| 471 | right_suffix = "_R" |
|---|
| 472 | # Read the mapping |
|---|
| 473 | mate_to_read_dict = {} |
|---|
| 474 | i = 0 |
|---|
| 475 | for i, line in enumerate( file( tmp_mates_mapping_file_name, 'rb' ) ): |
|---|
| 476 | line = line.strip() |
|---|
| 477 | if not line.startswith( "#" ): |
|---|
| 478 | fields = line.split() |
|---|
| 479 | if len( fields ) != 4: |
|---|
| 480 | skip_line( "num_fields", i+1, line ) |
|---|
| 481 | continue |
|---|
| 482 | mate_name, read_name, s_offset, e_offset = fields |
|---|
| 483 | if mate_name in mate_to_read_dict: |
|---|
| 484 | skip_line( 'two_mate_names', i+1, mate_name ) |
|---|
| 485 | continue |
|---|
| 486 | mate_to_read_dict[ mate_name ] = ( read_name, int( s_offset ), int( e_offset ) ) |
|---|
| 487 | # Read sequence data |
|---|
| 488 | read_to_nucs_dict = {} |
|---|
| 489 | seqs = 0 |
|---|
| 490 | fasta_reader = FastaReader( file( input2, 'rb' ) ) |
|---|
| 491 | while True: |
|---|
| 492 | seq = fasta_reader.next() |
|---|
| 493 | if not seq: |
|---|
| 494 | break |
|---|
| 495 | seqs += 1 |
|---|
| 496 | seq_text_upper = seq.text.upper() |
|---|
| 497 | if seq.name in read_to_nucs_dict: |
|---|
| 498 | if seq_text_upper != read_to_nucs_dict[ seq.name ]: |
|---|
| 499 | skip_line( 'inconsistent_reads', seqs, seq.name ) |
|---|
| 500 | continue |
|---|
| 501 | read_to_nucs_dict[ seq.name ] = seq_text_upper |
|---|
| 502 | # Read quality data |
|---|
| 503 | def quality_sequences( f ): |
|---|
| 504 | seq_name = None |
|---|
| 505 | seq_quals = None |
|---|
| 506 | line_number = 0 |
|---|
| 507 | for line in f: |
|---|
| 508 | line_number += 1 |
|---|
| 509 | line = line.strip() |
|---|
| 510 | if line.startswith( ">" ): |
|---|
| 511 | if seq_name != None: |
|---|
| 512 | yield ( seq_name, seq_quals, seq_line ) |
|---|
| 513 | seq_name = sequence_name( line ) |
|---|
| 514 | seq_line = line_number |
|---|
| 515 | seq_quals = [] |
|---|
| 516 | elif seq_name is None: |
|---|
| 517 | skip_line( 'no_header', line_number, line ) |
|---|
| 518 | continue |
|---|
| 519 | else: |
|---|
| 520 | seq_quals += [ int( q ) for q in line.split() ] |
|---|
| 521 | if seq_name is not None: |
|---|
| 522 | yield ( seq_name, seq_quals, seq_line ) |
|---|
| 523 | def sequence_name( s ): |
|---|
| 524 | s = s[ 1: ].strip() |
|---|
| 525 | if not s: |
|---|
| 526 | return "" |
|---|
| 527 | else: |
|---|
| 528 | return s.split()[ 0 ] |
|---|
| 529 | read_to_quals_dict = {} |
|---|
| 530 | # TODO: should we use Dan's fastaNamedReader here? |
|---|
| 531 | for seq_name, quals, line_number in quality_sequences( file( input4 ) ): |
|---|
| 532 | quals = samify_phred_scores( quals ) |
|---|
| 533 | if seq_name in read_to_quals_dict: |
|---|
| 534 | if quals != read_to_quals_dict[ seq_name ]: |
|---|
| 535 | skip_line( 'inconsistent_reads', line_number, seq_name ) |
|---|
| 536 | continue |
|---|
| 537 | if len( quals ) != len( read_to_nucs_dict[ seq_name ] ): |
|---|
| 538 | skip_line( 'inconsistent_read_lengths', line_number, seq_name ) |
|---|
| 539 | continue |
|---|
| 540 | read_to_quals_dict[ seq_name ] = quals |
|---|
| 541 | # process the SAM file |
|---|
| 542 | tmp_align_file_names = ' '.join( tmp_align_file_name_list ) |
|---|
| 543 | combined_chrom_file_name = get_tmp_file_name( suffix='combined_chrom' ) |
|---|
| 544 | command = 'cat %s | grep -v "^@" | sort -k 1 > %s' % ( tmp_align_file_names, combined_chrom_file_name ) |
|---|
| 545 | run_command( command ) |
|---|
| 546 | fout = file( output, 'w+b' ) |
|---|
| 547 | has_non_header = False |
|---|
| 548 | i = 0 |
|---|
| 549 | for i, line in enumerate( file( combined_chrom_file_name, 'rb' ) ): |
|---|
| 550 | line = line.strip() |
|---|
| 551 | if line.startswith( "@" ): |
|---|
| 552 | if has_non_header: |
|---|
| 553 | skip_line( 'sam_headers', i+1, line ) |
|---|
| 554 | continue |
|---|
| 555 | fout.write( "%s\n" % line ) |
|---|
| 556 | continue |
|---|
| 557 | has_non_header = True |
|---|
| 558 | fields = line.split() |
|---|
| 559 | num_fields = len( fields ) |
|---|
| 560 | if num_fields < SAM_MIN_COLUMNS: |
|---|
| 561 | skip_line( 'sam_min_columns', i+1, line ) |
|---|
| 562 | continue |
|---|
| 563 | # Set flags for mates |
|---|
| 564 | try: |
|---|
| 565 | flag = int( fields[ SAM_FLAG_COLUMN ] ) |
|---|
| 566 | except ValueError: |
|---|
| 567 | skip_line( 'sam_flag', i+1, line ) |
|---|
| 568 | continue |
|---|
| 569 | if not( flag & ( BAM_FPAIRED + BAM_FREAD1 + BAM_FREAD2 ) == 0 ): |
|---|
| 570 | skip_line( 'reads_paired', i+1, line ) |
|---|
| 571 | continue |
|---|
| 572 | mate_name = fields[ SAM_QNAME_COLUMN ] |
|---|
| 573 | unmap_it = False |
|---|
| 574 | half = None |
|---|
| 575 | if mate_name.endswith( left_suffix ): |
|---|
| 576 | flag += BAM_FPAIRED + BAM_FREAD2 |
|---|
| 577 | fields[ SAM_FLAG_COLUMN ] = "%d" % flag |
|---|
| 578 | unmap_it = True |
|---|
| 579 | half = "L" |
|---|
| 580 | elif mate_name.endswith( right_suffix ): |
|---|
| 581 | flag += BAM_FPAIRED + BAM_FREAD1 |
|---|
| 582 | fields[ SAM_FLAG_COLUMN ] = "%d" % flag |
|---|
| 583 | unmap_it = True |
|---|
| 584 | half = "R" |
|---|
| 585 | on_plus_strand = ( flag & BAM_FREVERSE == 0 ) |
|---|
| 586 | # Convert position from mate to read by adding clipping to cigar |
|---|
| 587 | if not unmap_it: |
|---|
| 588 | read_name = mate_name |
|---|
| 589 | else: |
|---|
| 590 | try: |
|---|
| 591 | read_name, s_offset, e_offset = mate_to_read_dict[ mate_name ] |
|---|
| 592 | except KeyError: |
|---|
| 593 | skip_line( 'missing_mate', i+1, mate_name ) |
|---|
| 594 | continue |
|---|
| 595 | cigar = fields[ SAM_CIGAR_COLUMN ] |
|---|
| 596 | cigar_prefix = None |
|---|
| 597 | cigar_suffix = None |
|---|
| 598 | if half == "L": |
|---|
| 599 | if on_plus_strand: |
|---|
| 600 | if s_offset > 0: |
|---|
| 601 | cigar_prefix = ( s_offset, "S" ) |
|---|
| 602 | if e_offset > 0: |
|---|
| 603 | cigar_suffix = ( e_offset, "H" ) |
|---|
| 604 | else: |
|---|
| 605 | if e_offset > 0: |
|---|
| 606 | cigar_prefix = ( e_offset, "H" ) |
|---|
| 607 | if s_offset > 0: |
|---|
| 608 | cigar_suffix = ( s_offset, "S" ) |
|---|
| 609 | elif half == "R": |
|---|
| 610 | if on_plus_strand: |
|---|
| 611 | if s_offset > 0: |
|---|
| 612 | cigar_prefix = ( s_offset, "H" ) |
|---|
| 613 | if e_offset > 0: |
|---|
| 614 | cigar_suffix = ( e_offset, "S" ) |
|---|
| 615 | else: |
|---|
| 616 | if e_offset > 0: |
|---|
| 617 | cigar_prefix = ( e_offset, "S" ) |
|---|
| 618 | if s_offset > 0: |
|---|
| 619 | cigar_suffix = ( s_offset, "H" ) |
|---|
| 620 | else: |
|---|
| 621 | if on_plus_strand: |
|---|
| 622 | if s_offset > 0: |
|---|
| 623 | cigar_prefix = ( s_offset, "S" ) |
|---|
| 624 | if e_offset > 0: |
|---|
| 625 | cigar_suffix = ( e_offset, "S" ) |
|---|
| 626 | else: |
|---|
| 627 | if e_offset > 0: |
|---|
| 628 | cigar_prefix = ( e_offset, "S" ) |
|---|
| 629 | if s_offset > 0: |
|---|
| 630 | cigar_suffix = ( s_offset, "S" ) |
|---|
| 631 | if cigar_prefix != None: |
|---|
| 632 | count, op = cigar_prefix |
|---|
| 633 | cigar = prefix_cigar( "%d%s" % ( count, op ), cigar ) |
|---|
| 634 | if op == "S": |
|---|
| 635 | refPos = int( fields[ SAM_POS_COLUMN ] ) - count |
|---|
| 636 | fields[ SAM_POS_COLUMN ] = "%d" % refPos |
|---|
| 637 | if cigar_suffix != None: |
|---|
| 638 | count, op = cigar_suffix |
|---|
| 639 | cigar = suffix_cigar( cigar,"%d%s" % ( count, op) ) |
|---|
| 640 | fields[ SAM_QNAME_COLUMN ] = read_name |
|---|
| 641 | fields[ SAM_CIGAR_COLUMN ] = cigar |
|---|
| 642 | # Fetch sequence and quality values, and flip/clip them |
|---|
| 643 | if read_name not in read_to_nucs_dict: |
|---|
| 644 | skip_line( 'missing_seq', i+1, read_name ) |
|---|
| 645 | continue |
|---|
| 646 | nucs = read_to_nucs_dict[ read_name ] |
|---|
| 647 | if not on_plus_strand: |
|---|
| 648 | nucs = reverse_complement( nucs ) |
|---|
| 649 | quals = None |
|---|
| 650 | if read_to_quals_dict != None: |
|---|
| 651 | if read_name not in read_to_quals_dict: |
|---|
| 652 | skip_line( 'missing_quals', i+1, read_name ) |
|---|
| 653 | continue |
|---|
| 654 | quals = read_to_quals_dict[ read_name ] |
|---|
| 655 | if not on_plus_strand: |
|---|
| 656 | quals = reverse_string( quals ) |
|---|
| 657 | cigar = split_cigar( fields[ SAM_CIGAR_COLUMN ] ) |
|---|
| 658 | nucs, quals = clip_for_cigar( cigar, nucs, quals ) |
|---|
| 659 | fields[ SAM_SEQ_COLUMN ] = nucs |
|---|
| 660 | if quals != None: |
|---|
| 661 | fields[ SAM_QUAL_COLUMN ] = quals |
|---|
| 662 | # Output the line |
|---|
| 663 | fout.write( "%s\n" % "\t".join( fields ) ) |
|---|
| 664 | fout.close() |
|---|
| 665 | |
|---|
| 666 | def prefix_cigar( prefix, cigar ): |
|---|
| 667 | ix = 0 |
|---|
| 668 | while cigar[ ix ].isdigit(): |
|---|
| 669 | ix += 1 |
|---|
| 670 | if cigar[ ix ] != prefix[ -1 ]: |
|---|
| 671 | return prefix + cigar |
|---|
| 672 | count = int( prefix[ :-1 ] ) + int( cigar[ :ix ] ) |
|---|
| 673 | return "%d%s%s" % ( count, prefix[ -1 ], cigar[ ix+1: ] ) |
|---|
| 674 | |
|---|
| 675 | def suffix_cigar( cigar, suffix ): |
|---|
| 676 | if cigar[ -1 ] != suffix[ -1 ]: |
|---|
| 677 | return cigar + suffix |
|---|
| 678 | ix = len( cigar ) - 2 |
|---|
| 679 | while cigar[ix].isdigit(): |
|---|
| 680 | ix -= 1 |
|---|
| 681 | ix += 1 |
|---|
| 682 | count = int( cigar[ ix:-1 ] ) + int( suffix[ :-1 ] ) |
|---|
| 683 | return "%s%d%s" % ( cigar[ :ix ], count, suffix[ -1 ] ) |
|---|
| 684 | |
|---|
| 685 | def split_cigar( text ): |
|---|
| 686 | fields = [] |
|---|
| 687 | field = [] |
|---|
| 688 | for ch in text: |
|---|
| 689 | if ch not in "MIDHS": |
|---|
| 690 | field += ch |
|---|
| 691 | continue |
|---|
| 692 | if field == []: |
|---|
| 693 | raise ValueError |
|---|
| 694 | fields += [ ( int( "".join( field ) ), ch ) ] |
|---|
| 695 | field = [] |
|---|
| 696 | if field != []: |
|---|
| 697 | raise ValueError |
|---|
| 698 | return fields |
|---|
| 699 | |
|---|
| 700 | def clip_for_cigar( cigar, nucs, quals ): |
|---|
| 701 | # Hard clip prefix |
|---|
| 702 | count, op = cigar[0] |
|---|
| 703 | if op == "H": |
|---|
| 704 | nucs = nucs[ count: ] |
|---|
| 705 | if quals != None: |
|---|
| 706 | quals = quals[ count: ] |
|---|
| 707 | count, op = cigar[ 1 ] |
|---|
| 708 | # Soft clip prefix |
|---|
| 709 | if op == "S": |
|---|
| 710 | nucs = nucs[ :count ].lower() + nucs[ count: ] |
|---|
| 711 | # Hard clip suffix |
|---|
| 712 | count,op = cigar[ -1 ] |
|---|
| 713 | if op == "H": |
|---|
| 714 | nucs = nucs[ :-count ] |
|---|
| 715 | if quals != None: |
|---|
| 716 | quals = quals[ :-count ] |
|---|
| 717 | count, op = cigar[ -2 ] |
|---|
| 718 | # Soft clip suffix |
|---|
| 719 | if op == "S": |
|---|
| 720 | nucs = nucs[ :-count ] + nucs[ -count: ].lower() |
|---|
| 721 | return nucs, quals |
|---|
| 722 | |
|---|
| 723 | def samify_phred_scores( quals ): |
|---|
| 724 | """ |
|---|
| 725 | Convert a decimal list of phred base-quality scores to a sam quality string. |
|---|
| 726 | Note that if a quality is outside the dynamic range of sam's ability to |
|---|
| 727 | represent it, we clip the value to the max allowed. SAM quality scores |
|---|
| 728 | range from chr(33) to chr(126). |
|---|
| 729 | """ |
|---|
| 730 | if min( quals ) >= 0 and max( quals ) <= 126-33: |
|---|
| 731 | return "".join( [ chr( 33 + q ) for q in quals ] ) |
|---|
| 732 | else: |
|---|
| 733 | return "".join( [ chr( max( 33, min( 126, 33+q ) ) ) for q in quals ] ) |
|---|
| 734 | |
|---|
| 735 | def reverse_complement( nucs ): |
|---|
| 736 | complementMap = maketrans( "ACGTacgt", "TGCAtgca" ) |
|---|
| 737 | return nucs[ ::-1 ].translate( complementMap ) |
|---|
| 738 | |
|---|
| 739 | def reverse_string( s ): |
|---|
| 740 | return s[ ::-1 ] |
|---|
| 741 | |
|---|
| 742 | def __main__(): |
|---|
| 743 | # Parse command line |
|---|
| 744 | # input1: a reference genome ( 2bit or fasta ) |
|---|
| 745 | # input2: a collection of 454 paired end reads ( a fasta file ) |
|---|
| 746 | # input3: a linker sequence ( a very small fasta file ) |
|---|
| 747 | # input4: a base quality score 454 file ( qual454 ) |
|---|
| 748 | parser = optparse.OptionParser() |
|---|
| 749 | parser.add_option( '', '--ref_name', dest='ref_name', help='The reference name to change all output matches to' ) |
|---|
| 750 | parser.add_option( '', '--ref_source', dest='ref_source', help='The reference is cached or from the history' ) |
|---|
| 751 | parser.add_option( '', '--ref_sequences', dest='ref_sequences', help='Number of sequences in the reference dataset' ) |
|---|
| 752 | parser.add_option( '', '--source_select', dest='source_select', help='Use pre-set or cached reference file' ) |
|---|
| 753 | parser.add_option( '', '--input1', dest='input1', help='The name of the reference file if using history or reference base name if using cached' ) |
|---|
| 754 | parser.add_option( '', '--input2', dest='input2', help='The 454 reads file to align' ) |
|---|
| 755 | parser.add_option( '', '--input3', dest='input3', help='The sequencing linker file' ) |
|---|
| 756 | parser.add_option( '', '--input4', dest='input4', help='The base quality score 454 file' ) |
|---|
| 757 | parser.add_option( '', '--output', dest='output', help='The output file' ) |
|---|
| 758 | parser.add_option( '', '--lastz_seqs_file_dir', dest='lastz_seqs_file_dir', help='Directory of local lastz_seqs.loc file' ) |
|---|
| 759 | |
|---|
| 760 | ( options, args ) = parser.parse_args() |
|---|
| 761 | if options.ref_name != 'None': |
|---|
| 762 | ref_name = '[nickname=%s]' % options.ref_name |
|---|
| 763 | else: |
|---|
| 764 | ref_name = '' |
|---|
| 765 | if options.ref_source == 'history': |
|---|
| 766 | # Reference is a fasta dataset from the history |
|---|
| 767 | try: |
|---|
| 768 | # Ensure there is at least 1 sequence in the dataset ( this may not be necessary ). |
|---|
| 769 | error_msg = "The reference dataset is missing metadata, click the pencil icon in the history item and 'auto-detect' the metadata attributes." |
|---|
| 770 | ref_sequences = int( options.ref_sequences ) |
|---|
| 771 | if ref_sequences < 1: |
|---|
| 772 | stop_err( error_msg ) |
|---|
| 773 | except: |
|---|
| 774 | stop_err( error_msg ) |
|---|
| 775 | else: |
|---|
| 776 | ref_sequences = 0 |
|---|
| 777 | tmp_w12_name = get_tmp_file_name( suffix='vs_linker.W12' ) |
|---|
| 778 | tmp_T1_name = get_tmp_file_name( suffix='vs_linker.T1' ) |
|---|
| 779 | # Run lastz twice ( with different options ) on the linker sequence and paired end reads, |
|---|
| 780 | # looking for the linker ( each run finds some the other doesn't ) |
|---|
| 781 | command = 'lastz %s %s W=12 --notrans --exact=18 --match=1,3 O=1 E=3 Y=10 L=18 --ambiguousn --coverage=85 --format=general-:name2,zstart2+,length2,size2 > %s' % \ |
|---|
| 782 | ( options.input3, options.input2, tmp_w12_name ) |
|---|
| 783 | run_command( command ) |
|---|
| 784 | command = 'lastz %s %s T=1 --match=1,2 O=1 E=2 X=15 K=10 Y=15 L=18 --ambiguousn --coverage=85 --format=general-:name2,zstart2+,length2,size2 > %s' % \ |
|---|
| 785 | ( options.input3, options.input2, tmp_T1_name ) |
|---|
| 786 | run_command( command ) |
|---|
| 787 | # Combine the alignment output from the two lastz runs |
|---|
| 788 | tmp_combined_linker_file_name = get_tmp_file_name( suffix='vs_linker' ) |
|---|
| 789 | command = 'cat %s %s | sort -u > %s' % ( tmp_w12_name, tmp_T1_name, tmp_combined_linker_file_name ) |
|---|
| 790 | run_command( command ) |
|---|
| 791 | # Use the alignment info to split reads into left and right mates |
|---|
| 792 | tmp_mates_mapping_file_name, tmp_mates_file_name, tmp_mates_short_file_name, tmp_mates_long_file_name = split_paired_reads( options.input2, tmp_combined_linker_file_name ) |
|---|
| 793 | # Align mates to the reference - tmp_align_file_names is a list of file names created by align_mates() |
|---|
| 794 | tmp_align_file_name_list = align_mates( options.input1, options.ref_source, ref_name, ref_sequences, tmp_mates_short_file_name, tmp_mates_long_file_name ) |
|---|
| 795 | # Combine and convert mate coordinates back to read coordinates |
|---|
| 796 | paired_mate_unmapper( options.input2, options.input4, tmp_mates_mapping_file_name, tmp_align_file_name_list, options.output ) |
|---|
| 797 | # Delete all temporary files |
|---|
| 798 | for file_name in tmp_file_names: |
|---|
| 799 | os.remove( file_name ) |
|---|
| 800 | # Handle any invalid lines in the input data |
|---|
| 801 | if total_skipped_lines: |
|---|
| 802 | msgs = dict( bad_interval="Bad interval in line", |
|---|
| 803 | inconsistent_read_lengths="Inconsistent read/quality lengths for seq #", |
|---|
| 804 | inconsistent_reads="Inconsistent reads for seq #", |
|---|
| 805 | inconsistent_sizes="Inconsistent sizes for seq #", |
|---|
| 806 | missing_mate="Mapping file does not include mate on line", |
|---|
| 807 | missing_quals="Missing quality values for name on line", |
|---|
| 808 | missing_seq="Missing sequence for name on line", |
|---|
| 809 | multiple_seqs="Multiple names for seq #", |
|---|
| 810 | no_header="First quality sequence has no header", |
|---|
| 811 | num_fields="Must have 4 fields in line", |
|---|
| 812 | reads_paired="SAM flag indicates reads already paired on line", |
|---|
| 813 | sam_flag="Bad SAM flag on line", |
|---|
| 814 | sam_headers="SAM headers on line", |
|---|
| 815 | sam_min_columns="Need 11 columns on line", |
|---|
| 816 | two_mate_names="Mate name already seen, line", |
|---|
| 817 | wrong_seq_len="Size differs from length of seq #" ) |
|---|
| 818 | print "Skipped %d invalid lines: " |
|---|
| 819 | msg = "" |
|---|
| 820 | for k, v in skipped_lines.items(): |
|---|
| 821 | if v[0]: |
|---|
| 822 | # v[0] is the number of times the error occurred |
|---|
| 823 | # v[1] is the position of the line or sequence in the file |
|---|
| 824 | # v[2] is the name of the sequence or the text of the line |
|---|
| 825 | msg += "(%d)%s %d:%s. " % ( v[0], msgs[k], v[1], v[2] ) |
|---|
| 826 | print msg |
|---|
| 827 | |
|---|
| 828 | if __name__=="__main__": __main__() |
|---|